Volume 13, Number 8—August 2007
Dispatch
PCR versus Hybridization for Detecting Virulence Genes of Enterohemorrhagic Escherichia coli
Table
Virulence factor targets and primers, including nucleotide sequences, reference, and PCR conditions*
Primer name | Nucleotide sequence (5′→3′) | Target (bp) | Ref. | PCR conditions |
||
---|---|---|---|---|---|---|
Denature | Anneal | Extension | ||||
STX1U | GTAACATCGCTCTTGCCACA | Stx1 gene (204) | This study | 95°C, 60 s | 53.7°C, 60 s | 72°C, 240 s |
STX1D | CGCTTTGCTGATTTTTCACA | |||||
STX2U | GTTCCGGAATGCAAATCAGT | Stx2 gene (206) | This study | 95°C, 60 s | 53.7°C, 60 s | 72°C, 240 s |
STX2D | CGGCGTCATCGTATACACAG | |||||
eae-1 | ACGTTGCAGCATGGGTAACTC | Intimin (818) | (8) | 95°C, 60 s | 57.1°C, 60 s | 72°C, 240 s |
eae-2 | GATCGGCAACAGTTTCACCTG | |||||
ToxBF | TGGCCTTGCGCTCTATAAGAACCT | ToxB (823) | This study | 95°C, 60 s | 60°C, 60 s | 72°C, 240 s |
ToxBR | ACCACGCCGTGAGAATAATGTCCA | |||||
HlyA1F | GGTGCAGCAGAAAAAGTTGTAG | HlyA (1551) | (13) | 95°C, 60 s | 55.5°C,60 s | 72°C, 240 s |
HlyA1R | TCTCGCCTGATAGTGTTTGGTA | |||||
EspPF | CGGCAGAGTATCATCAAGAGC | EspP (397) | This study | 95°C, 60 s | 55.5°C, 60 s | 72°C, 240 s |
EspPR | CATTAAATGGAGTTATGCGTC | |||||
KatPF | TTTAAAACGCTGGGATTTGC | KatP (1174) | This study | 95°C,60 s | 52.0°C, 60 s | 72°C, 240 s |
KatPR | CTCCTGAGAGGCGTCAGTTC | |||||
MalBU | GACCTCGGTTTAGTTCACAGA | MalB promoter (414) | This study | 95°C, 60 s | 55.8°C, 60 s | 72°C, 240 s |
MalBDn | AGCGCGTAGGACTGAAACACCATA | |||||
ORF1F | TTTTTCAAAGCAAATGATGTGG | ORF 1 pOSAK1 (385) | This study | 95°C, 60 s | 49.8°C, 60 s | 72°C, 240 s |
ORF1R | GGCGTAGCTAGGTTGAAATTATG | |||||
ORF2F | CAA CCTAGCTACGCCACCAT | ORF 2 pOSAK1 (869) | This study | 95°C, 60 s | 54.3°C, 60 s | 72°C, 240 s |
ORF2R | CATCAGGCGGAAATACCACT | |||||
EAF1 | CAGGGTAAAAGAAAGATGATAA | Eaf (397) | (14) | 95°C, 60 s | 49.8°C, 60 s | 72°C, 240 s |
EAF2 | TATGGGGACCATGTATTATCA | |||||
BFP1 | GATTGAATCTGCAATGGC | Bfp (597) | (15) | 95°C, 60 s | 51.6°C, 60 s | 72°C, 240 s |
BFP2 | GGATTACTGTCCTCACATAT |
*Ref., reference; ORF, open reading frame.
References
- Nataro JP, Kaper JB. Diarrheagenic Escherichia coli. Clin Microbiol Rev. 1998;11:142–201.PubMedGoogle Scholar
- Makino S, Tobe T, Asakura H, Watarai M, Ikeda T, Takeshi K, Distribution of the secondary type III secretion system locus found in enterohemorrhagic Escherichia coli O157:H7 isolates among Shiga toxin–producing E. coli strains. J Clin Microbiol. 2003;41:2341–7. DOIPubMedGoogle Scholar
- Hacker J, Kaper JB. Pathogenicity islands and the evolution of microbes. Annu Rev Microbiol. 2000;54:641–79. DOIPubMedGoogle Scholar
- Burland V, Shao Y, Perna NT, Plunkett G. Sofia HJBlattner FR. The complete DNA sequence and analysis of the large virulence plasmid of Escherichia coli O157:H7. Nucleic Acids Res. 1998;26:4196–204. DOIPubMedGoogle Scholar
- Farmer JJ III, Davis BR. H7 antiserum-sorbitol fermentation medium: a single tube screening medium for detecting Escherichia coli O157:H7 associated with hemorrhagic colitis. J Clin Microbiol. 1985;22:620–5.PubMedGoogle Scholar
- Osek J. Development of a multiplex PCR approach for the identification of Shiga toxin–producing Escherichia coli strains and their major virulence factor genes. J Appl Microbiol. 2003;95:1217–25. DOIPubMedGoogle Scholar
- Prager R, Annemuller S, Tschape H. Diversity of virulence patterns among Shiga toxin–producing Escherichia coli from human clinical cases-need for more detailed diagnostics. Int J Med Microbiol. 2005;295:29–38. DOIPubMedGoogle Scholar
- Brunder W, Schmidt H, Frosch M, Karch H. The large plasmids of Shiga-toxin–producing Escherichia coli (STEC) are highly variable genetic elements. Microbiology. 1999;145:1005–14. DOIPubMedGoogle Scholar
- Makino K, Ishii K, Yasunaga T, Hattori M, Yokoyama K, Yutsudo CH, Complete nucleotide sequences of 93-kb and 3.3-kb plasmids of an enterohemorrhagic Escherichia coli O157:H7 derived from Sakai outbreak. DNA Res. 1998;5:1–9. DOIPubMedGoogle Scholar
- Brunder W. Schmidt H, Karch H. KatP, a novel catalase-peroxidase encoded by the large plasmid of enterohaemorrhagic Escherichia coli O157:H7. Microbiology. 1996;142:3305–15. DOIPubMedGoogle Scholar
- Tatsuno I, Horie M, Abe H, Miki T, Makino K, Shinagawa H, toxB gene on pO157 of enterohemorrhagic Escherichia coli O157:H7 is required for full epithelial cell adherence phenotype. Infect Immun. 2001;69:6660–9. DOIPubMedGoogle Scholar
Page created: June 30, 2010
Page updated: June 30, 2010
Page reviewed: June 30, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.