Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 15, Number 3—March 2009
Dispatch

Rickettsia spp. in Ticks, Poland

Tomasz ChmielewskiComments to Author , Edyta Podsiadly, Grzegorz Karbowiak, and Stanislawa Tylewska-Wierzbanowska
Author affiliations: National Institute of Public Health, Warsaw, Poland (T. Chmielewski, E. Podsiadly, S. Tylewska-Wierzbanowska); W. Stefanski Institute of Parasitology of the Polish Academy of Sciences, Warsaw (G. Karbowiak)

Main Article

Table 1

Oligonucleotide primers used for PCR amplification and sequencing of rickettsial species in ticks, Poland, 2005–2007

No. Primers Fragment gene (size, bp) Nucleotide sequences (5′ → 3′) Reference
1 RpCS.409d Citrate synthase
(850)
 CCTATGGCTATTATGCTTGC (5)
RpCS.1258n
 ATTGCAAAAAGTACAGTGAACA
2 Rr190-70 Outer membrane protein A
(632)
 ATGGCGAATATTTCTCCAAAA (3)
Rr190-701
 GTTCCGTTAATGGCAGCATCT
3 Rr17.61p 17-kDa genus-common antigen
(434) GCTCTTGCA ACT TCT ATG TT (7)
Rr17.492n CATTGTTCGTCAGGTTGGCG

Main Article

References
  1. Fournier  P-E, Dumler  JS, Greub  G, Zhang  J, Wu  Y, Raoult  D. Gene sequence-based criteria for identification of new Rickettsia isolates and description of Rickettsia heilongjiangensis sp. nov. J Clin Microbiol. 2003;41:5456–65. DOIPubMedGoogle Scholar
  2. Fournier  PE, Roux  V, Raoult  D. Phylogenetic analysis of spotted fever group rickettsiae by study of the outer surface protein rOmpA. Int J Syst Bacteriol. 1998;48:839–49.PubMedGoogle Scholar
  3. Roux  V, Fournier  P-E, Raoult  D. Differentiation of spotted fever group rickettsiae by sequencing and analysis of restriction fragment length polymorphism of PCR-amplified DNA of the gene encoding the protein rOmpA. J Clin Microbiol. 1996;34:2058–65.PubMedGoogle Scholar
  4. Roux  V, Raoult  D. Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer-membrane protein rOmpB (ompB). Int J Syst Evol Microbiol. 2000;50:1449–55.PubMedGoogle Scholar
  5. Roux  V, Rydkina  E, Eremeeva  M, Raoult  D. Citrate synthase gene comparison, a new tool for phylogenetic analysis, and its application for the rickettsiae. Int J Syst Bacteriol. 1997;47:252–61.PubMedGoogle Scholar
  6. Shpynov  SN, Fournier  PE, Rudakov  NV, Samoilenko  IE, Reshetnikova  TA, Yastrebov  VK, Molecular identification of a collection of spotted fever group rickettsiae obtained from patients and ticks from Russia. Am J Trop Med Hyg. 2006;74:440–3.PubMedGoogle Scholar
  7. Webb  L, Carl  M, Malloy  DC, Dasch  GA, Azad  AF. Detection of murine typhus infection in fleas by using the polymerase chain reaction. J Clin Microbiol. 1990;28:530–4.PubMedGoogle Scholar
  8. Dautel  H, Dippel  C, Oehme  R, Hartelt  K, Schettler  E. Evidence for an increased geographical distribution of Dermacentor reticulatus in Germany and detection of Rickettsia sp. RpA4. Int J Med Microbiol. 2006;296(Suppl 40):149–56. DOIPubMedGoogle Scholar
  9. Rydkina  E, Roux  V, Rudakov  N, Gafarova  M, Tarasevich  I, Raoult  D. New Rickettsiae in ticks collected in territories of the former Soviet Union. Emerg Infect Dis. 1999;5:811–4.PubMedGoogle Scholar
  10. Shpynov  S, Fournier  P-E, Rudakov  N, Tankibaev  M, Tarasevich  I, Raoult  D. Detection of a rickettsia closely related to Rickettsia aeschlimanni, “Rickettsia heilongjiangensis,” Rickettsia sp. strain RpA4, and Ehrlichia muris in ticks collected in Russia and Kazakhstan. J Clin Microbiol. 2004;42:2221–3. DOIPubMedGoogle Scholar
  11. Mediannikov  O, Matsumoto  K, Samoylenko  I, Drancourt  M, Roux  V, Rydkina  E, Rickettsia raoultii sp. nov., a spotted fever group rickettsia associated with Dermacentor ticks in Europe and Russia. Int J Syst Evol Microbiol. 2008;58:1635–9. DOIPubMedGoogle Scholar
  12. Stanczak  J. Detection of spotted fever group (SFG) rickettsiae in Dermacentor reticulatus (Acari: Ixodidae) in Poland. Int J Med Microbiol. 2006;296(Suppl 40):144–8. DOIPubMedGoogle Scholar
  13. Sekeyová  Z, Roux  V, Xu  W, Rehácek  J, Raoult  D. Rickettsia slovaca sp. nov., a member of the spotted fever group rickettsiae. Int J Syst Bacteriol. 1998;48:1455–62.PubMedGoogle Scholar
  14. Stanczak  J. The occurrence of spotted fever group (SFG) rickettsiae in Ixodes ricinus ticks (Acari:Ixodidae) in northern Poland. Ann N Y Acad Sci. 2006;1078:512–4. DOIPubMedGoogle Scholar
  15. Nilsson  K, Lindquist  O, Påhlson  C. Association of Rickettsia helvetica with chronic perimyocarditis in sudden cardiac death. Lancet. 1999;354:1169–73. DOIPubMedGoogle Scholar

Main Article

Page created: December 07, 2010
Page updated: December 07, 2010
Page reviewed: December 07, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external