Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 15, Number 3—March 2009
Research

Integron-mediated Multidrug Resistance in a Global Collection of Nontyphoidal Salmonella enterica Isolates

Mary G. Krauland, Jane W. Marsh, David L. Paterson, and Lee H. HarrisonComments to Author 
Author affiliations: University of Pittsburgh School of Medicine and Graduate School of Public Health, Pittsburgh, Pennsylvania, USA (M.G. Krauland, J.W. March, D.L. Paterson, L.H. Harrison); University of Queensland, Royal Brisbane and Women’s Hospital, Brisbane, Queensland, Australia (D.L. Paterson)

Main Article

Table 2

Primers used for PCR amplification of Salmonella enterica integrons

Primer Sequence (5′ → 3′) Target Reference
5’CS GGCATCCAAGCAGCAAGC 5′ conserved segment (17)
3’CS AAGCAGACTTGACCTGAT 3′ conserved segment (17)
int_F CGATGCGTGGAGACCGAAACCTT intI1 (18)
int_R GTAACGCGCTTGCTGCTTGGATGC intI1 (18)
invA_F ACACAGCTCGTTTACGACCTGAAT invA (16)
invA_R AGACGACTGGTACTGATCGATATT invA (16)
sul1_F GCGCGGCGTGGGCTACC sul1 This study
sul1_R CCGCAAGGCTCGCTGGAC sul1 This study
aadA1_R CGATGACGCCAACTACCTCTGATA aadA1internal primer This study
arr2_F ATTGTTGGCGTTGTTGAAGACTGG arr2 internal primer This study
cmlA5_F GAATGGGAATGGGATGCCTGATAG cmlA5 internal primer This study
oxa10_R TTTACAAAGCACGAAGACACCATT blaOXA10 internal primer This study
cmlA_F GCAGGTCGCGAGGAAAGTAATG cmlA 5′ forward primer This study
cmlA_R ACACCGCCCAAGCAGAAGTAGA cmlA 3′ reverse primer This study
blaOXA30_F TCGCAAGAAATAACCCAAAAA blaOXA30 internal primer This study
aacA4_F AAGCGGGGTTTGAGAGG aacA4 forward primer This study
aacA4_R CGCGTACTCCTGGATCGGTTTCTT aacA4 reverse primer This study
dfr_1_F TTTAGGCCAGTTTTTACCCAAGAC dfrA1 internal primer This study
ere_est_R GCGCCAGCAGAATTATCCTTACAT ereA2 internal primer This study
aac(6’)IIC_F CCGCGGGATTGACCAGT aac(6′)IIC internal primer This study
dfrA12_F GCTGCGCATTTTGGTTCC dfrA12 internal primer This study
aadA2_R TGTCATTGCGCTGCCATTCTCC aadA2 internal primer This study
qacH_F GCGTCGCCGTTCTAAATCTGCTAT qacH internal primer This study
aac_R GGGCGCCGGGTGTCTGGAG aacA4 internal primer This study
IS_F GTCACGCCCCGACCATCACCTTCC IS1247 internal primer This study
TNP_F CCGCGCTGGCCGACCTGAAC Transposase A internal primer This study
ere_F CCTAACCGGGCGATTCAA Erythromycin esterase internal primer This study
cmlA_R_internal ATCACACGCCCCATAAAACGAG cmlA internal primer This study
arr_R2 GCGGGATCCAGAACCAGGCGACAT arr-2 internal primer This study
arr_accA_R AGAGCGGCTTTGGTTCC Internal primer arr-2–accA junction This study
ere_F2 CGCTGATTTCGCTGTCCTGA ereA internal primer This study
dfrA17_F AAAAAGGCTAACAAGTCGT dfrA17 internal primer This study
cml_R2 GCTGAATTGTGCTCGCTGTCGTA cml internal primer This study
aadA_con_F CGACATCATYCCGTGGCGTTAT aadA forward consensus primer This study
aadA_con_R CGGCAGCCACATCCTTC aadA reverse consensus primer This study
aacA4_F ATGACCTTGCGATGCTCT aacA4 internal primer This study
aacA4_R CTCGATGGAAGGGTTAGG aacA4 internal primer This study
blaOXA30_F ACACAATACATATCAACTTCGC blaOXA30-aadA internal primer This study
aadA1_R_S GGATAACGCCACGGAATGATGTC aadA1 internal primer This study
albany_PSE1a_F CCTTTGGGGCCACCTACAG blaPSE1 primer This study
albany_PSE1b_F ATCAAAATTATGGGGTTACTTACA blaPSE1 primer This study
albany_dfr1_F ATGGTAGCTATATCGAAGAATGGA dfr primer This study
albany_dfr2_F AAGTACTGGCTATTGCCTTAGGAG dfr primer This study
U7-L12 ACACCTTGAGCAGGGCAAAG SGI1 left junction (15)
LJ-R1 AGTTCTAAAGGTTCGTAGTCG SGI1 left junction (15)
104-RJ TGACGAGCTGAAGCGAATTG SGI1 right junction (15)
104-D ACCAGGGCAAAACTACACAG SGI1 right junction (15)

Main Article

References
  1. Hald  T, Lo Fo Wong  DM, Aarestrup  FM. The attribution of human infections with antimicrobial resistant Salmonella bacteria in Denmark to sources of animal origin. Foodborne Pathog Dis. 2007;4:313–26. DOIPubMedGoogle Scholar
  2. World Health Organization. World Health Organization antimicrobial resistance fact sheet no. 139. April 2003 [cited 2008 Mar 25]. Available from http://www.who.int/mediacentre/factsheets/fs139
  3. Voetsch  AC, Van Gilder  TJ, Angulo  FJ, Farley  MM, Shallow  S, Marcus  R, FoodNet estimate of the burden of illness caused by nontyphoidal Salmonella infections in the United States. Clin Infect Dis. 2004;38(Suppl 3):S127–34. DOIPubMedGoogle Scholar
  4. Mead  PS, Slutsker  L, Dietz  V, McCaig  LF, Bresee  JS, Shapiro  C, Food-related illness and death in the United States. Emerg Infect Dis. 1999;5:607–25.PubMedGoogle Scholar
  5. Centers for Disease Control and Prevention. National Antimicrobial Resistance Monitoring System for Enteric Bacteria (NARMS): human isolates final report, 2004. Atlanta: The Centers; 2007.
  6. Davis  MA, Hancock  DD, Besser  TE. Multiresistant clones of Salmonella enterica: the importance of dissemination. J Lab Clin Med. 2002;140:135–41. DOIPubMedGoogle Scholar
  7. Butaye  P, Michael  GB, Schwarz  S, Barrett  TJ, Brisabois  A, White  DG. The clonal spread of multidrug-resistant non-typhi Salmonella serotypes. Microbes Infect. 2006;8:1891–7. DOIPubMedGoogle Scholar
  8. Threlfall  EJ. Epidemic Salmonella typhimurium DT 104—a truly international multiresistant clone. J Antimicrob Chemother. 2000;46:7–10. DOIPubMedGoogle Scholar
  9. Roumagnac  P, Weill  FX, Dolecek  C, Baker  S, Brisse  S, Chinh  NT, Evolutionary history of Salmonella typhi. Science. 2006;314:1301–4. DOIPubMedGoogle Scholar
  10. Carattoli  A. Importance of integrons in the diffusion of resistance. Vet Res. 2001;32:243–59. DOIPubMedGoogle Scholar
  11. Blahna  MT, Zalewski  CA, Reuer  J, Kahlmeter  G, Foxman  B, Marrs  CF. The role of horizontal gene transfer in the spread of trimethoprim-sulfamethoxazole resistance among uropathogenic Escherichia coli in Europe and Canada. J Antimicrob Chemother. 2006;57:666–72. DOIPubMedGoogle Scholar
  12. Toleman  MA, Bennett  PM, Bennett  DM, Jones  RN, Walsh  TR. Global emergence of trimethoprim/sulfamethoxazole resistance in Stenotrophomonas maltophilia mediated by acquisition of sul genes. Emerg Infect Dis. 2007;13:559–65.PubMedGoogle Scholar
  13. Carattoli  A. Plasmid-mediated antimicrobial resistance in Salmonella enterica. Curr Issues Mol Biol. 2003;5:113–22.PubMedGoogle Scholar
  14. Carattoli  A, Villa  L, Pezzella  C, Bordi  E, Visca  P. Expanding drug resistance through integron acquisition by IncFI plasmids of Salmonella enterica Typhimurium. Emerg Infect Dis. 2001;7:444–7.PubMedGoogle Scholar
  15. Mulvey  MR, Boyd  DA, Olson  AB, Doublet  B, Cloeckaert  A. The genetics of Salmonella genomic island 1. Microbes Infect. 2006;8:1915–22. DOIPubMedGoogle Scholar
  16. Rahn  K, De Grandis  SA, Clarke  RC, McEwen  SA, Galan  JE, Ginocchio  C, Amplification of an invA gene sequence of Salmonella typhimurium by polymerase chain reaction as a specific method of detection of Salmonella. Mol Cell Probes. 1992;6:271–9. DOIPubMedGoogle Scholar
  17. Levesque  C, Piche  L, Larose  C, Roy  PH. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob Agents Chemother. 1995;39:185–91.PubMedGoogle Scholar
  18. Maguire  AJ, Brown  DF, Gray  JJ, Desselberger  U. Rapid screening technique for class 1 integrons in Enterobacteriaceae and nonfermenting gram-negative bacteria and its use in molecular epidemiology. Antimicrob Agents Chemother. 2001;45:1022–9. DOIPubMedGoogle Scholar
  19. Boyd  D, Cloeckaert  A, Chaslus-Dancla  E, Mulvey  MR. Characterization of variant Salmonella genomic island 1 multidrug resistance regions from serovars Typhimurium DT104 and Agona. Antimicrob Agents Chemother. 2002;46:1714–22. DOIPubMedGoogle Scholar
  20. Altschul  SF, Gish  W, Miller  W, Myers  EW, Lipman  DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403–10.PubMedGoogle Scholar
  21. Torpdahl  M, Skov  MN, Sandvang  D, Baggesen  DL. Genotypic characterization of Salmonella by multilocus sequence typing, pulsed-field gel electrophoresis and amplified fragment length polymorphism. J Microbiol Methods. 2005;63:173–84. DOIPubMedGoogle Scholar
  22. Falush  D, Torpdahl  M, Didelot  X, Conrad  DF, Wilson  DJ, Achtman  M. Mismatch induced speciation in Salmonella: model and data. Philos Trans R Soc Lond B Biol Sci. 2006;361:2045–53. DOIPubMedGoogle Scholar
  23. Kidgell  C, Reichard  U, Wain  J, Linz  B, Torpdahl  M, Dougan  G, Salmonella typhi, the causative agent of typhoid fever, is approximately 50,000 years old. Infect Genet Evol. 2002;2:39–45. DOIPubMedGoogle Scholar
  24. Harbottle  H, White  DG, McDermott  PF, Walker  RD, Zhao  S. Comparison of multilocus sequence typing, pulsed-field gel electrophoresis, and antimicrobial susceptibility typing for characterization of Salmonella enterica serotype Newport isolates. J Clin Microbiol. 2006;44:2449–57. DOIPubMedGoogle Scholar
  25. Guerra  B, Soto  SM, Arguelles  JM, Mendoza  MC. Multidrug resistance is mediated by large plasmids carrying a class 1 integron in the emergent Salmonella enterica serotype [4,5,12:i:-]. Antimicrob Agents Chemother. 2001;45:1305–8. DOIPubMedGoogle Scholar
  26. Ozgumus  OB, Celik-Sevim  E, Alpay-Karaoglu  S, Sandalli  C, Sevim  A. Molecular characterization of antibiotic resistant Escherichia coli strains isolated from tap and spring waters in a coastal region in Turkey. J Microbiol. 2007;45:379–87.PubMedGoogle Scholar
  27. Leverstein-van Hall  MA, Box  AT, Blok  HE, Paauw  A, Fluit  AC, Verhoef  J. Evidence of extensive interspecies transfer of integron-mediated antimicrobial resistance genes among multidrug-resistant Enterobacteriaceae in a clinical setting. J Infect Dis. 2002;186:49–56. DOIPubMedGoogle Scholar
  28. Boyd  DA, Peters  GA, Ng  L, Mulvey  MR. Partial characterization of a genomic island associated with the multidrug resistance region of Salmonella enterica Typhimurium DT104. FEMS Microbiol Lett. 2000;189:285–91. DOIPubMedGoogle Scholar
  29. O’Mahony  R, Quinn  T, Drudy  D, Walsh  C, Whyte  P, Mattar  S, Antimicrobial resistance in nontyphoidal salmonella from food sources in Colombia: evidence for an unusual plasmid-localized class 1 integron in serotypes typhimurium and anatum. Microb Drug Resist. 2006;12:269–77. DOIPubMedGoogle Scholar

Main Article

Page created: December 07, 2010
Page updated: December 07, 2010
Page reviewed: December 07, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external