Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 15, Number 4—April 2009


THEME ISSUE
The Amazon Region
Research

Human Febrile Illness Caused by Encephalomyocarditis Virus Infection, Peru

M. Steven Oberste, Eduardo Gotuzzo, Patrick Blair, W. Allan Nix, Thomas G. Ksiazek, James A. Comer, Pierre E. Rollin, Cynthia S. Goldsmith, James Olson, and Tadeusz J. Kochel
Author affiliations: Centers for Disease Control and Prevention, Atlanta, Georgia, USA (M.S. Oberste, W.A. Nix, T.G. Ksiazek, J.A. Comer, P. Rollin, C.S. Goldsmith); Universidad Peruana Cayetano Heredia, Lima, Peru (E. Gotuzzo); Naval Medical Research Center Detachment, Lima (P. Blair, J. Olson, T.J. Kochel)

Main Article

Table

Oligonucleotide primers used for cardiovirus PCR amplification and sequencing*

Primer Sequence (5′ → 3′) Region Coordinates Reference
AN312 GARTVWCGYRAAGRAAGCAGT 5′-NTR 455–475 This study
AN315 GGYRCTGGGGTTGYRCCGC 5′-NTR 618–600 This study
AN283 GCAGACGGWTGGGTNACNGTNTGG VP3 2559–2582 This study
AN285 AGAGTAACCTCTACRTCRCAYTTRTA VP1 3097–3072 This study
AN393 TTTCCACTCAAGTCTAARCARGAYT VP1 3015–3049 This study
AN286 AAGAAGACAGTCGGACGNGGRCARAANAC VP1 3472–3444 This study
P1 CCCTACCTCACGGAATGGGGCAAAG 3D 7655–7631 (24)
P2 GGTGAGAGCAAGCCTCGCAAAGACAG 3D 7370–7395 (24)

*NTR, nontranslated region; VP1, viral protein 1.

Main Article

References
  1. Tesh  RB, Wallace  GD. Observations on the natural history of encephalomyocarditis virus. Am J Trop Med Hyg. 1978;27:133–43.PubMedGoogle Scholar
  2. Grobler  DG, Raath  JP, Braack  LE, Keet  DF, Gerdes  GH, Barnard  BJ, An outbreak of encephalomyocarditis-virus infection in free-ranging African elephants in the Kruger National Park. Onderstepoort J Vet Res. 1995;62:97–108.PubMedGoogle Scholar
  3. Helwig  FC, Schmidt  CH. A filter-passing agent producing interstitial myocarditis in anthropoid apes and small animals. Science. 1945;102:31–3. DOIPubMedGoogle Scholar
  4. Hubbard  GB, Soike  KF, Butler  TM, Carey  KD, Davis  H, Butcher  WI, An encephalomyocarditis virus epizootic in a baboon colony. Lab Anim Sci. 1992;42:233–9.PubMedGoogle Scholar
  5. Reddacliff  LA, Kirkland  PD, Hartley  WJ, Reece  RL. Encephalomyocarditis virus infections in an Australian zoo. J Zoo Wildl Med. 1997;28:153–7.PubMedGoogle Scholar
  6. Roca-Garcia  M, Sanmartin-Barber  C. The isolation of encephalomyocarditis virus from Aotus monkeys. Am J Trop Med Hyg. 1957;6:840–52.PubMedGoogle Scholar
  7. Jones  P, Mahamba  C, Rest  J, André  C. Fatal inflammatory heart disease in a bonobo (Pan paniscus). J Med Primatol. 2005;34:45–9. DOIPubMedGoogle Scholar
  8. Murnane  TG, Craighead  JE, Mondragon  H, Shelokov  A. Fatal disease of swine due to encephalomyocarditis virus. Science. 1960;131:498–9. DOIPubMedGoogle Scholar
  9. Seaman  JT, Boulton  JG, Carrigan  MJ. Encephalomyocarditis virus disease of pigs associated with a plague of rodents. Aust Vet J. 1986;63:292–4. DOIPubMedGoogle Scholar
  10. Dick  GWA, Best  AM, Haddow  AJ, Smithburn  KC. Mengo encephalomyelitis, a hitherto unknown virus affecting man. Lancet. 1948;252:286–9. DOIGoogle Scholar
  11. Gajdusek  DC. Encephalomyocarditis virus infection in childhood. Pediatr. 1955;16:902–6.
  12. Verlinde  JD, Tongeren  V. Human infection with viruses of the Columbia SK group. Arch Gesamte Virusforsch. 1953;5:217–27. DOIPubMedGoogle Scholar
  13. Jones  MS, Lukashov  VV, Ganac  RD, Schnurr  DP. Discovery of a novel human picornavirus in a stool sample from a pediatric patient presenting with fever of unknown origin. J Clin Microbiol. 2007;45:2144–50. DOIPubMedGoogle Scholar
  14. Abed  Y, Boivin  G. New Saffold cardioviruses in 3 children, Canada. Emerg Infect Dis. 2008;14:834–6. DOIPubMedGoogle Scholar
  15. Drexler  JF, Luna  LK, Stöcker  A, Silva Almeida  PS, Medrado Ribeiro  TC, Petersen  N, Circulation of 3 lineages of a novel human Saffold cardiovirus in humans. Emerg Infect Dis. 2008;14:1398–405. DOIPubMedGoogle Scholar
  16. Chiu  CY, Greninger  AL, Kanada  K, Kwok  T, Fisher  KF, Runckel  C, Identification of cardioviruses related to Theiler's murine encephalomyelitis virus in human infections. Proc Natl Acad Sci U S A. 2008;105:14124–9. DOIPubMedGoogle Scholar
  17. Jonkers  AH. Serosurvey of encephalomyocarditis virus neutralizing antibodies in southern Louisiana and Peruvian Indian populations. Am J Trop Med Hyg. 1961;10:593–8.PubMedGoogle Scholar
  18. Jungblut  CW, Bautista  G Jr. Antibodies against Col-SK virus in Mexican sera. Am J Trop Med Hyg. 1954;3:466–74.PubMedGoogle Scholar
  19. Gajdusek  DC, Rogers  NG. Specific serum antibodies to infectious disease agents in Tarahumara Indian adolescents of northwestern Mexico. Pediatr. 1955;16:819–35.
  20. Seligmann  E, Jungblut  CW. Neutralization of SK murine poliomyelitis virus and of Theiler's virus of mouse encephalomyelitis by human sera. Am J Public Health. 1943;33:1326–32. DOIGoogle Scholar
  21. Smithburn  KC. Neutralizing antibodies against certain recently isolated viruses in the sera of human beings residing in East Africa. J Immunol. 1952;69:223–34.PubMedGoogle Scholar
  22. Tesh  RB. The prevalence of encephalomyocarditis virus neutralizing antibodies among various human populations. Am J Trop Med Hyg. 1978;27:144–9.PubMedGoogle Scholar
  23. Gubler  DJ, Kuno  G, Sather  GE, Velez  M, Oliver  A. Mosquito cell cultures and specific monoclonal antibodies in surveillance for dengue viruses. Am J Trop Med Hyg. 1984;33:158–65.PubMedGoogle Scholar
  24. Koenen  F, Vanderhallen  H, Dickenson  ND, Knowles  NJ. Phylogenetic analysis of European encephalomyocarditis viruses: comparison of two genomic regions. Arch Virol. 1999;144:893–903. DOIPubMedGoogle Scholar
  25. Thompson  JD, Gibson  TJ, Plewniak  F, Jeanmougin  F, Higgins  DG. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997;25:4876–82. DOIPubMedGoogle Scholar
  26. Sutter  RW, Pallansch  MA, Sawyer  LA, Cochi  SL, Hadler  SC. Defining surrogate serologic tests with respect to predicting protective vaccine efficacy: poliovirus vaccination. Ann N Y Acad Sci. 1995;754:289–99. DOIPubMedGoogle Scholar
  27. Finney  DJ. Statistical methods in biological assays. 2nd ed. New York: Hafner Publishing; 1964.
  28. Kuno  G, Gomez  I, Gubler  DJ. Detecting artificial anti-dengue IgM immune complexes using an enzyme-linked immunosorbent assay. Am J Trop Med Hyg. 1987;36:153–9.PubMedGoogle Scholar
  29. Bienz  K, Egger  D, Pasamontes  L. Association of polioviral proteins of the P2 genomic region with the viral replication complex and virus-induced membrane synthesis as visualized by electron microscopic immunocytochemistry and autoradiography. Virology. 1987;160:220–6. DOIPubMedGoogle Scholar
  30. Hirasawa  K, Takeda  M, Matsuzaki  H, Doi  K. Encephalomyocarditis (EMC) virus-induced orchitis in Syrian hamsters. Int J Exp Pathol. 1991;72:617–22.PubMedGoogle Scholar
  31. Altman  R. Clinical aspects of enterovirus infection. Postgrad Med. 1964;35:451–9.PubMedGoogle Scholar
  32. Harb  JM, Hiramoto  Y, Burch  GE. Phagocytosis of injured hepatocytes following inoculation with encephalomyocarditis virus. Exp Mol Pathol. 1974;20:199–207. DOIPubMedGoogle Scholar
  33. Thoren  A, Robinson  AJ, Maguire  T, Jenkins  R. Two-step PCR in the retrospective diagnosis of enteroviral viraemia. Scand J Infect Dis. 1992;24:137–41. DOIPubMedGoogle Scholar
  34. Prather  SL, Dagan  R, Jenista  JA, Menegus  MA. The isolation of enteroviruses from blood: a comparison of four processing methods. J Med Virol. 1984;14:221–7. DOIPubMedGoogle Scholar

Main Article

Page created: December 10, 2010
Page updated: December 10, 2010
Page reviewed: December 10, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external