Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 15, Number 6—June 2009

Research

Hantaviruses in Rodents and Humans, Inner Mongolia Autonomous Region, China

Yong-Zhen ZhangComments to Author , Feng-Xian Zhang, Na Gao, Jian-Bo Wang, Zhi-Wei Zhao, Ming-Hui Li, Hua-Xin Chen, Yang Zou, and Alexander Plyusnin
Author affiliations: Chinese Center for Disease Control and Prevention, Changping, Beijing, People’s Republic of China (Y.-Z. Zhang, F.-X. Zhang, N. Gao, M.-H. Li, H.-X. Chen, Y. Zou); Huhehaote Center for Disease Control and Prevention, Huhehaote, Inner Mongolia Autonomous Region, People’s Republic of China (F.-X. Zhang); Yakeshi Center for Disease Control and Prevention,Yakeshi, Inner Mongolia Autonomous Region, People’s Republic of China (J.-B. Wang); Bayannaoer Center for Disease Control and Prevention, Bayannaoer, Inner Mongolia Autonomous Region, People’s Republic of China (Z.-W. Zhao); Haartman Institute, University of Helsinki, Helsinki, Finland (A. Plyusnin)

Main Article

Table 1

Specific primers used to detect hantavirus RNA in rodents, Inner Mongolia Autonomous Region, China, 2003–2006*

Type Primer Sequence (5′ → 3′) Segment† Reference
P14 TAGTAGTAGACTCC L, M, S (16)
HV-SFO GGCCAGACAGCAGATTGG S (+) (17)
HV-SRO AGCTCAGGATCCATGTCATC S (–) (17)
HTNV HSF AACAAGAGGAAGGCAAACAAC S (+) (18)
HSR GCCCCAAGCTCAGCAATACC S (–) (18)
SEOV SEO-SF TGCCAAACGCCCAATCCA S (+) (18)
SEO-SR GCCATCCCTCCGACAAACAA S (–) (18)

*HTNV, Hantaan virus; SEOV, Seoul virus.
†The hantavirus genome consists of 3 segments defined as small (S), medium (M), and large (L). The segments encode the nucleocapsid protein, 2 envelope glycoproteins, and viral RNA-dependent RNA polymerase, respectively.

Main Article

References
  1. Schmaljohn  C, Hjelle  B. Hantaviruses: a global disease problem. Emerg Infect Dis. 1997;3:95104.PubMedGoogle Scholar
  2. Chen  HX, Qiu  FX. Epidemiological surveillance on the hemorrhagic fever with renal syndrome in China. Chin Med J. 1993;106:85763.PubMedGoogle Scholar
  3. Vapalahti  K, Paunio  M, Brummer-Korvenkontio  M, Vaheri  A, Vapalahti  O. Puumala virus infections in Finland: increased occupational risk for farmers. Am J Epidemiol. 1999;149:114251.PubMedGoogle Scholar
  4. Chen  HX, Qiu  FX, Dong  BJ, Ji  SZ, Li  YT, Wang  Y, Epidemiological studies on hemorrhagic fever with renal syndrome in China. J Infect Dis. 1986;154:3948.PubMedGoogle Scholar
  5. Zhang  YZ, Xiao  DL, Wang  Y, Wang  HX, Sun  L, Tao  XX, The epidemic characteristics and preventive measures of hemorrhagic fever with renal syndrome in China [in Chinese]. Zhonghua Liu Xing Bing Xue Za Zhi. 2004;25:4669.PubMedGoogle Scholar
  6. Yan  L, Fang  LQ, Huang  HG, Zhang  LQ, Feng  D, Zhao  WJ, Landscape elements and Hantaan virus-related hemorrhagic fever with renal syndrome, People's Republic of China. Emerg Infect Dis. 2007;13:13016.PubMedGoogle Scholar
  7. Chen  HX, Qiu  FX. Studies on the environment structure of natural nidi and epidemic areas of hemorrhagic fever with renal syndrome in China. Chin Med J. 1994;107:10712.PubMedGoogle Scholar
  8. Wang  H, Yoshimatsu  K, Ebihara  H, Ogino  M, Araki  K, Kariwa  H, Genetic diversity of hantaviruses isolated in China and characterization of novel hantaviruses isolated from Niviventer confucianus and Rattus rattus. Virology. 2000;278:33245. DOIPubMedGoogle Scholar
  9. Zhang  YZ, Zou  Y, Yan  YZ, Hu  GW, Yao  LS, Du  ZS, Detection of phylogenetically distinct Puumala-like viruses from red-grey vole Clethrionomys rufocanus in China. J Med Virol. 2007;79:120818. DOIPubMedGoogle Scholar
  10. Zou  Y, Wang  JB, Gaowa  HS, Yao  LS, Hu  GW, Li  MH, Isolation and genetic characterization of hantaviruses carried by Microtus voles in China. J Med Virol. 2008;80:6808. DOIPubMedGoogle Scholar
  11. Zou  Y, Xiao  QY, Dong  X, Lv  W, Zhang  SP, Li  MH, Genetic analysis of hantaviruses carried by reed voles Microtus fortis in China. Virus Res. 2008;137:1228. DOIPubMedGoogle Scholar
  12. Wang  JB, Wu  GH, Zhu  JH, Li  CP, Xu  XA, Zhang  BC, Surveillance of hemorrhagic fever in Yakeshi. In: Chen HX, Luo CW, editors. Hemorrhagic fever with renal syndrome [in Chinese]. Hong Kong: Hong Kong Medical Publisher; 2001. p. 185–90.
  13. Han  Y, Sun  LP. Epidemic investigation on hemorrhagic fever of renal syndrome in Hulunbeier, 1990–1999 [in Chinese]. Chin J Dis Control Prevention. 2002;6:2545.
  14. Liu  QH, Wang  M, Ba  G. Geographical epidemiological investigation of epidemiological fever in the Inner Mongolia Autonomous Region [in Chinese]. In: Luo Z, Liu GZ, editors. Geographical epidemiological investigation of epidemiological fever in China. Hefei (China): Anhui Press Bureau; 1990. p. 74–86.
  15. Zhang  YZ, Dong  X, Li  X. Seoul virus and hantavirus disease, Shenyang, People’s Republic of China. Emerg Infect Dis. 2009;15:2006. DOIPubMedGoogle Scholar
  16. Schmaljohn  CS, Jennings  GB, Hay  J, Dalrymple  JM. Coding strategy of the S genome segment of Hantaan virus. Virology. 1986;155:63343. DOIPubMedGoogle Scholar
  17. Puthavathana  P, Lee  HW, Kang  CY. Typing of hantaviruses from five continents by polymerase chain reaction. Virus Res. 1992;26:114. DOIPubMedGoogle Scholar
  18. Sun  L, Zhang  YZ, Li  LH, Zhang  YP, Zhang  AM, Hao  ZY, Genetics subtypes and distribution of Seoul virus in Henan [in Chinese]. Zhonghua Liu Xing Bing Xue Za Zhi. 2005;26:57882.PubMedGoogle Scholar
  19. Zhang  YZ, Zou  Y, Yao  LS, Hu  GW, Du  ZS, Jin  LZ, Isolation and characterization of hantavirus carried by Apodemus peninsulae in Jilin, China. J Gen Virol. 2007;88:1295301. DOIPubMedGoogle Scholar
  20. Bi  P, Tong  S, Donald  K, Parton  K, Ni  J. Climatic, reservoir and occupational variables and the transmission of haemorrhagic fever with renal syndrome in China. Int J Epidemiol. 2002;31:18993. DOIPubMedGoogle Scholar
  21. Mills  JN, Childs  JE. Ecologic studies of rodent reservoirs: their relevance for human health. Emerg Infect Dis. 1998;4:52937.PubMedGoogle Scholar
  22. Mi  EY, Mei  ZQ. Geographical epidemiological investigation of epidemiological fever in Shanxi province[in Chinese]. In: Luo Z, Liu GZ, editors. Geographical epidemiological investigation of epidemiological fever in China. Hefei (China): Anhui Press Bureau; 1990. p. 64–73.
  23. Zhang  ZR, Meng  ZD, Zhu  JZ, Qi  SX, Gao  GJ. Geographical epidemiological investigation of epidemiological fever in Hebei province [in Chinese]. In: Luo Z, Liu GZ, editors. Geographical epidemiological investigation of epidemiological fever in China. Hefei (China): Anhui Press Bureau; 1990. p. 52–63.
  24. Han  ZY, Zhang  YB, Yu  QL, Wei  YM, Zhang  WZ, Xu  YG, Analysis of surveillance data of host animals of HFRS in Hebei province [in Chinese]. Chin Public Health. 2007;23:9878.
  25. Li  J, Zhao  ZT, Wang  ZQ, Liu  YX, Hu  MH. Nucleotide sequence characterization and phylogenetic analysis of hantaviruses isolated in Shandong province, China. Chin Med J. 2007;120:82530.PubMedGoogle Scholar
  26. Zhang  YZ, Xiao  QY, Li  MH, Zou  Y, Lv  W, Dai  DF, An epidemiologic investigation of hantaviruses carried by rodent hosts in Hunan province [in Chinese]. Zhonghua Liu Xing Bing Xue Za Zhi. 2007;28:659.PubMedGoogle Scholar
  27. Plyusnin  A, Morzunov  SP. Virus evolution and genetic diversity of hantaviruses and their rodent hosts. Curr Top Microbiol Immunol. 2001;256:4775.PubMedGoogle Scholar
  28. Wu  XD, Fu  HP. Rodent communities in desert and semi-desert regions in Inner Mongolia [in Chinese]. Acta Zoologica Sinica. 2005;51:96172.
  29. Zhang  RZ, Jing  SK, Quan  GQ, Li  SH, Ye  ZY, Wang  FG, , eds. Distribution of mammalian species in China. Beijing: China Forestry Publishing House; 1997. p. 191–2.

Main Article

Page created: December 08, 2010
Page updated: December 08, 2010
Page reviewed: December 08, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external