Volume 16, Number 12—December 2010
Letter
Molecular Detection of Bartonella alsatica in Rabbit Fleas, France
Table
Oligonucleotide primers and TaqMan* fluorescent probe sequences of hsp60 and gyrB genes used for reverse transcription PCRs of Bartonella alsatica†
| Gene |
Oligonucleotide |
Sequence (5′ → 3′) |
Length, bp |
Amplicon size, bp |
| hsp60 | B_alsa_hsp60_F | TGCTAACGCTATGGAAAAAGTTG | 23 | 108 |
| B_alsa_hsp60_R | CCACGATCAAACTGCATTCC | 20 | ||
| B_alsa_hsp60_P |
6FAM-TGTCGAAGAAGCAAAAACGGCTGAAACC-TAMRA |
28 |
||
| gyrB | B_alsa_gyrB_F | CGAAGCAAAACTTCTTATTAGTAAGGT | 27 | 126 |
| B_alsa_gyrB_R | GCAAGCTTTCCTGGCAGAG | 19 | ||
| B_alsa_gyrB_P | 6FAM-ATAGAGGCTGCTGCGGCGCG-TAMRA | 20 |
*Applied Biosystems, Courtaboeuf, France.
†hsp60, heat shock protein 60; gyrB, DNA gyrase subunit B.
Page created: August 29, 2011
Page updated: August 29, 2011
Page reviewed: August 29, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.