Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 16, Number 9—September 2010
Research

Worldwide Diversity of Klebsiella pneumoniae That Produce β-Lactamase blaKPC-2 Gene1

Gaëlle Cuzon, Thierry NaasComments to Author , HaVy Truong, Maria-Virginia Villegas, Karin T. Wisell, Yehuda Carmeli, Ana. C. Gales, Shiri Navon-Venezia, John P. Quinn, and Patrice Nordmann
Author affiliations: Author affiliations: Institut National de la Santé et de la Recherche Médicale, Paris, France (G. Cuzon, T. Naas, H. Truong, P. Nordmann); International Center for Medical Research and Training, Cali, Colombia (M.V. Villegas); Swedish Institute for Infectious Disease Control, Stockholm, Sweden (K.T. Wisell); Sourasky Medical Center, Tel Aviv, Israel (Y. Carmeli, S. Navon-Venezia); Universidade Federal de São Paulo, São Paulo, Brazil (A.C. Gales); John H. Stroger Jr. Hospital of Cook County, Chicago, Illinois, USA (J.P. Quinn); Chicago Infectious Disease Research Institute, Chicago (J.P. Quinn)

Main Article

Table 2

Primers used for PCR of Klebsiella pneumoniae isolates producing β-lactamase blaKPC-2 gene*

Primer name Primer no.† Sequence, 5′ → 3′
KpcA 1 CTGTCTTGTCTCTCATGGCC
KpcB 2 CCTCGCTGTGCTTGTCATCC
4281 3 GGCACGGCAAATGACTA
4714 4 GAAGATGCCAAGGTCAATGC
EcoRIout 5 CACCCGACCTGGACGAACTA
3′YCEnd 6 GCATCAAACGGAAGCAAAAG
3781L 7 CACAGCGGCAGCAAGAAAGC
3098U 8 TGACCCTGAGCGGCGAAAGC
905L 9 GCGACCGGTCAGTTCCTTCT
816U 10 CACCTACACCACGACGAACC
141R-6 11 TCACCGGCCCTCACCTTTGG
5′endYC 12 CTTAGCAAATGTGGTGAACG
Pre-SHV-5 U – GGTCAGCGCGAGAAGCATCC
Pre-SHV-5 L – AAATAGCGTTCATCGTCAAT
Pre-TEM 1 – GTATCCGCTCATGAGACAATA
Pre-TEM 2 – TCTAAAGTATATATGAGTAAACTTGGTCTG
OXA-9 A – TTCGTTTCCGCCACTCTCCC
OXA-9 B – ACGAGAATATCCTCTCGTGC
CTX-M A – CGCTTTGCGATGTGTCAG
CTX-M B – ACC GCG ATA TCG TTG GT

*Primers from (21).
†Numbers correspond to those in Figure 1, panel A. – indicates primer not shown in Figure 1, panel A.

Main Article

References
  1. Nordmann  P, Poirel  L. Emerging carbapenemases in gram-negatives aerobes. Clin Microbiol Infect. 2002;8:321–31. DOIPubMedGoogle Scholar
  2. Queenan  AM, Bush  K. Carbapenemases: the versatile beta-lactamases. Clin Microbiol Rev. 2007;20:440–58. DOIPubMedGoogle Scholar
  3. Poirel  L, Héritier  C, Tolun  V, Nordmann  P. Emergence of oxacillinase-mediated resistance to imipenem in Klebsiella pneumoniae. Antimicrob Agents Chemother. 2004;48:15–22. DOIPubMedGoogle Scholar
  4. Nordmann  P, Cuzon  G, Naas  T. The real threat of KPC carbapenemase–producing bacteria. Lancet Infect Dis. 2009;9:228–36. DOIPubMedGoogle Scholar
  5. Yigit  H, Queenan  AM, Anderson  GJ, Domenech-Sanchez  A, Biddle  JW, Steward  CD, Novel carbapenem-hydrolyzing β-lactamase KPC-1 from a carbapenem-resistant strain of Klebsiella pneumoniae. Antimicrob Agents Chemother. 2001;45:1151–61. DOIPubMedGoogle Scholar
  6. Bradford  PA, Bratu  S, Urban  C, Visalli  M, Mariano  N, Landman  D, Emergence of carbapenem-resistant Klebsiella species possessing the class A carbapenem-hydrolyzing KPC-2 and inhibitor-resistant TEM-30 β-lactamases in New York City. Clin Infect Dis. 2004;39:55–60. DOIPubMedGoogle Scholar
  7. Landman  D, Bratu  S, Kochar  S, Panwar  M, Trehan  M, Doymaz  M, Evolution of antimicrobial resistance among Pseudomonas aeruginosa, Acinetobacter baumannii and Klebsiella pneumoniae in Brooklyn, NY. J Antimicrob Chemother. 2007;60:78–82. DOIPubMedGoogle Scholar
  8. Kitchel  B, Rasheed  JK, Patel  JB, Srinivasan  A, Navon-Venezia  S, Carmeli  Y, Molecular epidemiology of KPC-producing Klebsiella pneumoniae in the United States: clonal expansion of MLST sequence type 258. Antimicrob Agents Chemother. 2009;53:3365–70. DOIPubMedGoogle Scholar
  9. Miriagou  V, Tzouvelekis  LS, Rossiter  S, Tzelepi  E, Angulo  FJ, Whichard  J. Imipenem resistance in a Salmonella clinical strain due to plasmid-mediated class A carbapenemase KPC-2. Antimicrob Agents Chemother. 2003;47:1297–300. DOIPubMedGoogle Scholar
  10. Wolter  DJ, Khalaf  N, Robledo  IE, Vazquez  GJ, Sante  MI, Aquino  EE, Surveillance of carbapenem-resistant Pseudomonas aeruginosa from Puerto Rico medical center hospitals: dissemination of KPC and IMP-18 beta-lactamases. Antimicrob Agents Chemother. 2009;53:1660–4. DOIPubMedGoogle Scholar
  11. Naas  T, Nordmann  P, Vedel  G, Poyart  C. Plasmid-mediated carbapenem-hydrolyzing β-lactamase KPC in a Klebsiella pneumoniae isolate from France. Antimicrob Agents Chemother. 2005;49:4423–4. DOIPubMedGoogle Scholar
  12. Leavitt  A, Navon-Venezia  S, Chmelnitsky  I, Schwaber  MJ, Carmeli  Y. Emergence of KPC-2 and KPC-3 in carbapenem-resistant Klebsiella pneumoniae strains in an Israeli hospital. Antimicrob Agents Chemother. 2007;51:3026–9. DOIPubMedGoogle Scholar
  13. Villegas  MV, Lolans  K, Correa  A, Suarez  CJ, Lopez  JA, Vallejo  M; Colombian Nosocomial Resistance Study Group. First detection of the plasmid-mediated class A carbapenemase KPC-2 in clinical isolates of Klebsiella pneumoniae from South America. Antimicrob Agents Chemother. 2006;50:2880–2. DOIPubMedGoogle Scholar
  14. Monteiro  J, Fernandes Santos  A, Asensi  MD, Peirano  G, Gales  AC. First report of KPC-2–producing Klebsiella pneumoniae strains in Brazil. Antimicrob Agents Chemother. 2009;53:333–4. DOIPubMedGoogle Scholar
  15. Pasteran  FG, Otaegui  L, Guerriero  L, Radice  G, Maggiora  R, Rapoport  M, Klebsiella pneumoniae carbapenemase-2, Buenos Aires, Argentina. Emerg Infect Dis. 2008;14:1178–80. DOIPubMedGoogle Scholar
  16. Villegas  MV, Lolans  K, Correa  A, Kattan  JN, Lopez  JA, Quinn  JP; Colombian Nosocomial Resistance Study Group. First identification of Pseudomonas aeruginosa isolates producing a KPC-type carbapenem-hydrolyzing β-lactamase. Antimicrob Agents Chemother. 2007;51:1553–5. DOIPubMedGoogle Scholar
  17. Cai  JC, Zhou  HW, Zhang  R, Chen  GX. Emergence of Serratia marscescens, Klebsiella pneumoniae, and Escherichia coli possessing the plasmid-mediated carbapenem-hydrolyzing β-lactamase KPC-2 in intensive care units from a Chinese hospital. Antimicrob Agents Chemother. 2008;52:2014–8. DOIPubMedGoogle Scholar
  18. Pournaras  S, Protonotariou  E, Voulgari  E, Kristo  I, Dimitroulia  E, Vitti  D, Clonal spread of KPC-2 carbapenemase-producing Klebsiella pneumoniae strains in Greece. J Antimicrob Chemother. 2009;64:348–52. DOIPubMedGoogle Scholar
  19. Navon-Venezia  S, Leavitt  A, Schwaber  MJ, Rasheed  JK, Srinivasan  A, Patel  JB, First report on hyper-epidemic clone of KPC-3 producing Klebsiella pneumoniae in Israel genetically related to a strain causing outbreaks in the United States. Antimicrob Agents Chemother. 2009;53:818–20. DOIPubMedGoogle Scholar
  20. Woodford  N, Zhang  J, Warner  M, Kaufmann  ME, Matos  J, Macdonald  A, Arrival of Klebsiella pneumoniae producing KPC carbapenemase in the United Kingdom. J Antimicrob Chemother. 2008;62:1261–4. DOIPubMedGoogle Scholar
  21. Cuzon  G, Naas  T, Demachy  MC, Nordmann  P. Plasmid-mediated carbapenem-hydrolyzing β-lactamase KPC in a Klebsiella pneumoniae isolate from Greece. Antimicrob Agents Chemother. 2008;52:796–7. DOIPubMedGoogle Scholar
  22. Naas  T, Cuzon  G, Villegas  MV, Lartigue  MF, Quinn  JP, Nordmann  P. Genetic structures at the origin of acquisition of the beta-lactamase blaKPC gene. Antimicrob Agents Chemother. 2008;52:1257–63. DOIPubMedGoogle Scholar
  23. Wolter  DJ, Kurpiel  PM, Woodford  N, Palepou  MF, Goering  RV, Hanson  ND. Phenotypic and enzymatic comparative analysis of the novel KPC variant KPC-5 and its evolutionary variants, KPC-2 and KPC-4. Antimicrob Agents Chemother. 2009;53:557–62. DOIPubMedGoogle Scholar
  24. Shen  P, Wei  Z, Jiang  Y, Du  X, Ji  S, Yu  Y, Novel genetic environment of the carbapenem-hydrolysing beta-lactamase KPC-2 among Enterobacteriaceae in China. Antimicrob Agents Chemother. 2009;53:4333–8. DOIPubMedGoogle Scholar
  25. Tegmark Wisell  K, Haeggman  S, Gazelius  L, Thompson  O, Gustafsson  I, Ripa  T, Identification of Klebsiella pneumoniae carbapenemase in Sweden. Euro Surveill. 2007;12:E071220.3.
  26. Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; fifteenth informational supplement. M100–S15. Wayne (PA): The Institute; 2005.
  27. Kieser  T. Factors affecting the isolation of CCC DNA from Streptomyces lividans and Escherichia coli. Plasmid. 1984;12:19–36. DOIPubMedGoogle Scholar
  28. Sambrook  J, Fritsch  EF, Maniatis  T. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor (NY): Cold Spring Harbor Laboratory Press; 1989.
  29. Carrër  A, Lassel  L, Fortineau  N, Mansouri  M, Anguel  N, Richard  C, Outbreak of CTX-M-15–producing Klebsiella pneumoniae in the intensive care unit of a French hospital. Microb Drug Resist. 2009;15:47–54. DOIPubMedGoogle Scholar
  30. Tenover  FC, Arbeit  R, Goering  V, Mickelsen  PA, Murray  BE, Persing  DH, Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol. 1995;33:2233–9.PubMedGoogle Scholar
  31. Diancourt  L, Passet  V, Verhoef  J, Grimont  PA, Brisse  S. Multilocus sequence typing of Klebsiella pneumoniae nosocomial isolates. J Clin Microbiol. 2005;43:4178–82. DOIPubMedGoogle Scholar
  32. Carattoli  A, Bertini  A, Villa  L, Falbo  V, Hopkins  KL, Threlfall  EJ. Identification of plasmids by PCR-based replicon typing. J Microbiol Methods. 2005;63:219–28. DOIPubMedGoogle Scholar
  33. Falagas  ME, Rafailidis  PI, Ioannidou  E, Alexiou  VG, Matthaiou  DK, Karageorgopoulos  DE, Colistin therapy for microbiologically documented multidrug-resistant gram-negative bacterial infections: a retrospective cohort study of 258 patients. Int J Antimicrob Agents. 2010;35:194–9. Epub 2009 Dec 16. DOIPubMedGoogle Scholar
  34. Hæggman  S, Löfdahl  S, Paauw  A, Verhoef  J, Brisse  S. Diversity and evolution of the class A chromosomal beta-lactamase gene in Klebsiella pneumoniae. Antimicrob Agents Chemother. 2004;48:2400–8. DOIPubMedGoogle Scholar
  35. Gootz  TD, Lescoe  MK, Dib-Hajj  F, Dougherty  BA, He  W, Della-Latta  P, Genetic organization of transposase regions surrounding blaKPC carbapenemase genes on plasmids from Klebsiella strains isolated in a New York City hospital. Antimicrob Agents Chemother. 2009;53:1998–2004. DOIPubMedGoogle Scholar
  36. Samuelsen  O, Naseer  U, Tofteland  S, Skutlaberg  DH, Onken  A, Hjetland  R, Emergence of clonally related Klebsiella pneumoniae isolates of sequence type 258 producing plasmid-mediated KPC carbapenemase in Norway and Sweden. J Antimicrob Chemother. 2009;63:654–8. DOIPubMedGoogle Scholar
  37. Baraniak  A, Izdebski  R, Herda  M, Fiett  J, Hryniewicz  W, Gniadkowski  M. The emergence of Klebsiella pneumoniae ST258 with KPC-2 in Poland. Antimicrob Agents Chemother. 2009;53:4565–7. DOIPubMedGoogle Scholar
  38. Damjanova  I, Toth  A, Paszti  J, Hajbel-Vekony  G, Jakab  M, Berta  J, Expansion and countrywide dissemination of ST11, ST15 and ST147 ciprofloxacin-resistant CTX-M-15–type beta-lactamase–producing Klebsiella pneumoniae epidemic clones in Hungary in 2005—the new “MRSAs”? J Antimicrob Chemother. 2008;62:978–85. DOIPubMedGoogle Scholar
  39. Endimiani  A, Hujer  AM, Perez  F, Bethel  CR, Hujer  KM, Kroeger  J, Characterization of blaKPC-containing Klebsiella pneumoniae isolates detected in different institutions in the eastern USA. J Antimicrob Chemother. 2009;63:427–37. DOIPubMedGoogle Scholar
  40. Willems  RJ, Top  J, Van den Braak  N, Van Belkum  A, Mevius  DJ, Hendriks  G, Molecular diversity and evolutionary relationships of Tn1546-like elements in enterococci from humans and animals. Antimicrob Agents Chemother. 1999;43:483–91.PubMedGoogle Scholar

Main Article

1This study was presented in part at the Interscience Conference on Antimicrobial Agents and Chemotherapy; 2009 Sep 12–15; San Francisco, CA, USA.

Page created: August 28, 2011
Page updated: August 28, 2011
Page reviewed: August 28, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external