Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 16, Number 9—September 2010

Dispatch

Human Herpesvirus 8 Genotype E in Patients with Kaposi Sarcoma, Peru

Olivier Cassar1, Marie-Lise Blondot1, Salim Mohanna, Gregory Jouvion, Francisco Bravo, Vicente Maco, Renan Duprez, Michel Huerre, Eduardo Gotuzzo, and Antoine GessainComments to Author 
Author affiliations: Author affiliations: Institut Pasteur, Paris, France (O. Cassar, M.-L. Blondot, G. Jouvion, R. Duprez, M. Huerre, A. Gessain); Centre National de la Recherche Scientifique, Paris (O. Cassar, M.-L. Blondot, R. Duprez, A. Gessain); Universidad Peruana Cayetano Heredia, Lima, Peru (S. Mohanna, F. Bravo, V. Maco, E. Gotuzzo)

Main Article

Table A1

Patient and tumor characteristics and results of immunohistochemical analyses and molecular typing of VR1 and VR2 of the open reading frame K1 of HHV-8 in patients with KS, Peru*

ID IP Age, y/sex Origin Lesion No. lesions Biopsy site HIV status Clinical diagnosis Level of spindle cells infiltration Perls CD 34 LANA-1 VR1 PCR†
VR2 PCR
Subtype by molecular analysis
VR1 outer VR1 inner VR2 outer VR2 inner
04/0480 51/M Mestizo Nodule 1 Neck + AIDS KS ++ +++ ++ ++ + E + E – + E E
04/0484 29/M Mestizo Nodule Multiple Nose + AIDS KS +++ ++ ++ ++ + C + C – – C
04/0485 29/M Mestizo Nodule Multiple Head + AIDS KS +++ + ++ ++ + C + C – + C C
04/0489 32/M Mestizo Macula 1 Hard palate + AIDS KS ++ ++ ++ + – + B – + B B
04/0492 34/F Mestizo Macula Multiple Face + AIDS KS +++ +++ ++ ++ + A + A – + A A
04/0497 32/M Mestizo Patch Multiple Chest + AIDS KS +++ +++ ++ ++ – + C – +‡ C
06/0749 35/F Mestizo Macula Multiple Hard palate + AIDS KS + + + + + C + C – – C
06/0750 35/M Mestizo Macula, nodule Multiple Hard palate + AIDS KS ++ ++ + ++ – +‡ C – – C
06/0758 37/M Mestizo Nodule 1 Eyelid + AIDS KS + ++ ++ +/− – + A – – A
06/0772 24/M Mestizo Papula, nodule Multiple Upper limb + AIDS KS + + + + + E + E + E + E E
04/0479 83/F Mestizo Papula 1 Lower limb – Classic KS +++ + + ++ – + C – + C C
04/0482 75/M Mestizo Nodule Multiple Hand – Classic KS +++ +++ ++ ++ +‡ + C – + C C
04/0487 70/F Quechua Nodule 1 Foot – Classic KS +++ +++ + ++ – + C – + C C
04/0488 75/M Mestizo Nodule Multiple Foot – Classic KS +++ ++ + ++ – + C – + C C
04/0498 75/M Quechua Nodule 1 Foot – Classic KS +++ +++ ++ ++ + A + A + A + A A
06/0733 58/M Mestizo Macula Multiple Hard palate – Classic KS – - + +/− – + C – – C
06/0739 46/M Mestizo Patch Multiple Upper limb – Classic KS + +/− ++ ++ – + A – + A A
06/0741 30/M Mestizo Nodule 1 Face – Classic KS +++ + ++ +++ + A + A + A +‡ A
06/0743 30/M Mestizo Nodule Multiple Face – Classic KS ++ ++ + ++ + C + C – – C
06/0745 31/M Mestizo Papula, nodule Multiple Lower limb – Classic KS + + + + – + C – – C
06/0751 26/M Quechua Macula 1 Hard palate – Classic KS +++ +++ + ++ + C + C – +‡ C
06/0754 63/F Mestizo Nodule Multiple Neck – Classic KS ++ +/− +++ +++ + A + A – +‡ A
06/0767 76/F Quechua Nodule 1 Lower limb – Classic KS – – +++ – – + C + C + C C
04/0491 63/F Mestizo Nodule ND Foot – ND ++ + + ++ – +‡ A – +‡ A A
04/0494 75/F ND Nodule ND Foot – ND ++ ++ + ++ + A + A – – A

*KS, Kaposi sarcoma; VR1 and VR2, variable region 1 or 2 of the open reading frame K1 of HHV-8; HHV-8, human herpesvirus 8; ID IP, identification of the specimen given by the Institut Pasteur pathologic unit; LANA, latency-associated nuclear antigen; AIDS KS, KS occurring with HIV-1 infection; –, no amplification product. ND, not determined.
†For VR1, the first PCR was performed with the primer set VR1S (ATCCTTGCCAAYATCCTGGTATTGBAA) / VR1AS1 (ACGATTTGACAGGCGAGACGACAGC) (amplification of 373 bp) and followed by a nested PCR with a second set of primers VR1S/VR1AS2 (ACAATRCAAAGTAACABGCTGRCC) for the amplification of a 220-bp fragment. For VR2 amplification, the first PCR was performed by using the primer set VR2S (TCTCGCCTGTCAAATCBTMTATGT) / VR2AS1(AGTACCAMTCCACTGGTTGYGTAT) amplification of 314 bp and followed by a nested PCR with a second set of primers VR2S/VR2AS2 (AGTTCCTAMGATACCAMACATGGTT) for the amplification of a 240–300-bp fragment. Amplified PCR products of the appropriate size were then purified from gel, cloned, sequenced as previously described (14). Sequences were verified on both DNA strands.
‡Weak PCR signal.

Main Article

References
  1. Dourmishev  LA, Dourmishev  AL, Palmeri  D, Schwartz  RA, Lukac  DM. Molecular genetics of Kaposi’s sarcoma–associated herpesvirus (human herpesvirus 8) epidemiology and pathogenesis. Microbiol Mol Biol Rev. 2003;67:175–212. DOIPubMedGoogle Scholar
  2. Schulz  TF. The pleiotropic effects of Kaposi’s sarcoma herpesvirus. J Pathol. 2006;208:187–98. DOIPubMedGoogle Scholar
  3. Parkin  DM. The global health burden of infection-associated cancers in the year 2002. Int J Cancer. 2006;118:3030–44. DOIPubMedGoogle Scholar
  4. Hayward  GS, Zong  JC. Modern evolutionary history of the human KSHV genome. Curr Top Microbiol Immunol. 2007;312:1–42. DOIPubMedGoogle Scholar
  5. Biggar  RJ, Whitby  D, Marshall  V, Linhares  AC, Black  F. Human herpesvirus 8 in Brazilian Amerindians: a hyperendemic population with a new subtype. J Infect Dis. 2000;181:1562–8. DOIPubMedGoogle Scholar
  6. Kazanji  M, Dussart  P, Duprez  R, Tortevoye  P, Pouliquen  JF, Vandekerkhove  J, Serological and molecular evidence that human herpesvirus 8 is endemic among Amerindians in French Guiana. J Infect Dis. 2005;192:1525–9. DOIPubMedGoogle Scholar
  7. Whitby  D, Marshall  VA, Bagni  RK, Wang  CD, Gamache  CJ, Guzman  JR, Genotypic characterization of Kaposi’s sarcoma–associated herpesvirus in asymptomatic infected subjects from isolated populations. J Gen Virol. 2004;85:155–63. DOIPubMedGoogle Scholar
  8. de Souza  VA, Sumita  LM, Nascimento  MC, Oliveira  J, Mascheretti  M, Quiroga  M, Human herpesvirus-8 infection and oral shedding in Amerindian and non-Amerindian populations in the Brazilian Amazon region. J Infect Dis. 2007;196:844–52. DOIPubMedGoogle Scholar
  9. Ishak  MO, Martins  RN, Machado  PR, de Souza  LL, Machado  LF, Azevedo  VN, High diversity of HHV-8 molecular subtypes in the Amazon region of Brazil: evidence of an ancient human infection. J Med Virol. 2007;79:1537–44. DOIPubMedGoogle Scholar
  10. Mohanna  S, Bravo  F, Ferrufino  JC, Sanchez  J, Gotuzzo  E. Classic Kaposi’s sarcoma presenting in the oral cavity of two HIV-negative Quechua patients. Med Oral Patol Oral Cir Bucal. 2007;12:E365–8.PubMedGoogle Scholar
  11. Mohanna  S, Portillo  JA, Carriquiry  G, Oliveira  J, Mascheretti  M, Quiroga  M, Human herpesvirus-8 in Peruvian blood donors: a population with hyperendemic disease? Clin Infect Dis. 2007;44:558–61. DOIPubMedGoogle Scholar
  12. Hbid  O, Belloul  L, Fajali  N, Ismaili  N, Duprez  R, Tanguy  M, Kaposi’s sarcoma in Morocco: a pathological study with immunostaining for human herpesvirus-8 LNA-1. Pathology. 2005;37:288–95. DOIPubMedGoogle Scholar
  13. Kadyrova  E, Lacoste  V, Duprez  R, Pozharissky  K, Molochkov  V, Huerre  M, Molecular epidemiology of Kaposi’s sarcoma–associated herpesvirus/human herpesvirus 8 strains from Russian patients with classic, posttransplant, and AIDS-associated Kaposi’s sarcoma. J Med Virol. 2003;71:548–56. DOIPubMedGoogle Scholar
  14. Lacoste  V, Judde  JG, Briere  J, Tulliez  M, Garin  B, Kassa-Kelembho  E, Molecular epidemiology of human herpesvirus 8 in Africa: both B and A5 K1 genotypes, as well as the M and P genotypes of K14.1/K15 loci, are frequent and widespread. Virology. 2000;278:60–74. DOIPubMedGoogle Scholar
  15. Dukers  NH, Rezza  G. Human herpesvirus 8 epidemiology: what we do and do not know. AIDS. 2003;17:1717–30. DOIPubMedGoogle Scholar

Main Article

1These authors contributed equally to this article.

Page created: August 28, 2011
Page updated: August 28, 2011
Page reviewed: August 28, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external