Volume 16, Number 9—September 2010
Dispatch
Human Herpesvirus 8 Genotype E in Patients with Kaposi Sarcoma, Peru
Table A1
Patient and tumor characteristics and results of immunohistochemical analyses and molecular typing of VR1 and VR2 of the open reading frame K1 of HHV-8 in patients with KS, Peru*
| ID IP | Age, y/sex | Origin | Lesion | No. lesions | Biopsy site | HIV status | Clinical diagnosis | Level of spindle cells infiltration | Perls | CD 34 | LANA-1 | VR1 PCR† |
VR2 PCR |
Subtype by molecular analysis | |||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| VR1 outer | VR1 inner | VR2 outer | VR2 inner | ||||||||||||||
| 04/0480 | 51/M | Mestizo | Nodule | 1 | Neck | + | AIDS KS | ++ | +++ | ++ | ++ | + E | + E | – | + E | E | |
| 04/0484 | 29/M | Mestizo | Nodule | Multiple | Nose | + | AIDS KS | +++ | ++ | ++ | ++ | + C | + C | – | – | C | |
| 04/0485 | 29/M | Mestizo | Nodule | Multiple | Head | + | AIDS KS | +++ | + | ++ | ++ | + C | + C | – | + C | C | |
| 04/0489 | 32/M | Mestizo | Macula | 1 | Hard palate | + | AIDS KS | ++ | ++ | ++ | + | – | + B | – | + B | B | |
| 04/0492 | 34/F | Mestizo | Macula | Multiple | Face | + | AIDS KS | +++ | +++ | ++ | ++ | + A | + A | – | + A | A | |
| 04/0497 | 32/M | Mestizo | Patch | Multiple | Chest | + | AIDS KS | +++ | +++ | ++ | ++ | – | + C | – | +‡ | C | |
| 06/0749 | 35/F | Mestizo | Macula | Multiple | Hard palate | + | AIDS KS | + | + | + | + | + C | + C | – | – | C | |
| 06/0750 | 35/M | Mestizo | Macula, nodule | Multiple | Hard palate | + | AIDS KS | ++ | ++ | + | ++ | – | +‡ C | – | – | C | |
| 06/0758 | 37/M | Mestizo | Nodule | 1 | Eyelid | + | AIDS KS | + | ++ | ++ | +/− | – | + A | – | – | A | |
| 06/0772 | 24/M | Mestizo | Papula, nodule | Multiple | Upper limb | + | AIDS KS | + | + | + | + | + E | + E | + E | + E | E | |
| 04/0479 | 83/F | Mestizo | Papula | 1 | Lower limb | – | Classic KS | +++ | + | + | ++ | – | + C | – | + C | C | |
| 04/0482 | 75/M | Mestizo | Nodule | Multiple | Hand | – | Classic KS | +++ | +++ | ++ | ++ | +‡ | + C | – | + C | C | |
| 04/0487 | 70/F | Quechua | Nodule | 1 | Foot | – | Classic KS | +++ | +++ | + | ++ | – | + C | – | + C | C | |
| 04/0488 | 75/M | Mestizo | Nodule | Multiple | Foot | – | Classic KS | +++ | ++ | + | ++ | – | + C | – | + C | C | |
| 04/0498 | 75/M | Quechua | Nodule | 1 | Foot | – | Classic KS | +++ | +++ | ++ | ++ | + A | + A | + A | + A | A | |
| 06/0733 | 58/M | Mestizo | Macula | Multiple | Hard palate | – | Classic KS | – | - | + | +/− | – | + C | – | – | C | |
| 06/0739 | 46/M | Mestizo | Patch | Multiple | Upper limb | – | Classic KS | + | +/− | ++ | ++ | – | + A | – | + A | A | |
| 06/0741 | 30/M | Mestizo | Nodule | 1 | Face | – | Classic KS | +++ | + | ++ | +++ | + A | + A | + A | +‡ | A | |
| 06/0743 | 30/M | Mestizo | Nodule | Multiple | Face | – | Classic KS | ++ | ++ | + | ++ | + C | + C | – | – | C | |
| 06/0745 | 31/M | Mestizo | Papula, nodule | Multiple | Lower limb | – | Classic KS | + | + | + | + | – | + C | – | – | C | |
| 06/0751 | 26/M | Quechua | Macula | 1 | Hard palate | – | Classic KS | +++ | +++ | + | ++ | + C | + C | – | +‡ | C | |
| 06/0754 | 63/F | Mestizo | Nodule | Multiple | Neck | – | Classic KS | ++ | +/− | +++ | +++ | + A | + A | – | +‡ | A | |
| 06/0767 | 76/F | Quechua | Nodule | 1 | Lower limb | – | Classic KS | – | – | +++ | – | – | + C | + C | + C | C | |
| 04/0491 | 63/F | Mestizo | Nodule | ND | Foot | – | ND | ++ | + | + | ++ | – | +‡ A | – | +‡ A | A | |
| 04/0494 | 75/F | ND | Nodule | ND | Foot | – | ND | ++ | ++ | + | ++ | + A | + A | – | – | A | |
*KS, Kaposi sarcoma; VR1 and VR2, variable region 1 or 2 of the open reading frame K1 of HHV-8; HHV-8, human herpesvirus 8; ID IP, identification of the specimen given by the Institut Pasteur pathologic unit; LANA, latency-associated nuclear antigen; AIDS KS, KS occurring with HIV-1 infection; –, no amplification product. ND, not determined.
†For VR1, the first PCR was performed with the primer set VR1S (ATCCTTGCCAAYATCCTGGTATTGBAA) / VR1AS1 (ACGATTTGACAGGCGAGACGACAGC) (amplification of 373 bp) and followed by a nested PCR with a second set of primers VR1S/VR1AS2 (ACAATRCAAAGTAACABGCTGRCC) for the amplification of a 220-bp fragment. For VR2 amplification, the first PCR was performed by using the primer set VR2S (TCTCGCCTGTCAAATCBTMTATGT) / VR2AS1(AGTACCAMTCCACTGGTTGYGTAT) amplification of 314 bp and followed by a nested PCR with a second set of primers VR2S/VR2AS2 (AGTTCCTAMGATACCAMACATGGTT) for the amplification of a 240–300-bp fragment. Amplified PCR products of the appropriate size were then purified from gel, cloned, sequenced as previously described (14). Sequences were verified on both DNA strands.
‡Weak PCR signal.
References
- Dourmishev LA, Dourmishev AL, Palmeri D, Schwartz RA, Lukac DM. Molecular genetics of Kaposi’s sarcoma–associated herpesvirus (human herpesvirus 8) epidemiology and pathogenesis. Microbiol Mol Biol Rev. 2003;67:175–212. DOIPubMedGoogle Scholar
- Schulz TF. The pleiotropic effects of Kaposi’s sarcoma herpesvirus. J Pathol. 2006;208:187–98. DOIPubMedGoogle Scholar
- Parkin DM. The global health burden of infection-associated cancers in the year 2002. Int J Cancer. 2006;118:3030–44. DOIPubMedGoogle Scholar
- Hayward GS, Zong JC. Modern evolutionary history of the human KSHV genome. Curr Top Microbiol Immunol. 2007;312:1–42. DOIPubMedGoogle Scholar
- Biggar RJ, Whitby D, Marshall V, Linhares AC, Black F. Human herpesvirus 8 in Brazilian Amerindians: a hyperendemic population with a new subtype. J Infect Dis. 2000;181:1562–8. DOIPubMedGoogle Scholar
- Kazanji M, Dussart P, Duprez R, Tortevoye P, Pouliquen JF, Vandekerkhove J, Serological and molecular evidence that human herpesvirus 8 is endemic among Amerindians in French Guiana. J Infect Dis. 2005;192:1525–9. DOIPubMedGoogle Scholar
- Whitby D, Marshall VA, Bagni RK, Wang CD, Gamache CJ, Guzman JR, Genotypic characterization of Kaposi’s sarcoma–associated herpesvirus in asymptomatic infected subjects from isolated populations. J Gen Virol. 2004;85:155–63. DOIPubMedGoogle Scholar
- de Souza VA, Sumita LM, Nascimento MC, Oliveira J, Mascheretti M, Quiroga M, Human herpesvirus-8 infection and oral shedding in Amerindian and non-Amerindian populations in the Brazilian Amazon region. J Infect Dis. 2007;196:844–52. DOIPubMedGoogle Scholar
- Ishak MO, Martins RN, Machado PR, de Souza LL, Machado LF, Azevedo VN, High diversity of HHV-8 molecular subtypes in the Amazon region of Brazil: evidence of an ancient human infection. J Med Virol. 2007;79:1537–44. DOIPubMedGoogle Scholar
- Mohanna S, Bravo F, Ferrufino JC, Sanchez J, Gotuzzo E. Classic Kaposi’s sarcoma presenting in the oral cavity of two HIV-negative Quechua patients. Med Oral Patol Oral Cir Bucal. 2007;12:E365–8.PubMedGoogle Scholar
- Mohanna S, Portillo JA, Carriquiry G, Oliveira J, Mascheretti M, Quiroga M, Human herpesvirus-8 in Peruvian blood donors: a population with hyperendemic disease? Clin Infect Dis. 2007;44:558–61. DOIPubMedGoogle Scholar
- Hbid O, Belloul L, Fajali N, Ismaili N, Duprez R, Tanguy M, Kaposi’s sarcoma in Morocco: a pathological study with immunostaining for human herpesvirus-8 LNA-1. Pathology. 2005;37:288–95. DOIPubMedGoogle Scholar
- Kadyrova E, Lacoste V, Duprez R, Pozharissky K, Molochkov V, Huerre M, Molecular epidemiology of Kaposi’s sarcoma–associated herpesvirus/human herpesvirus 8 strains from Russian patients with classic, posttransplant, and AIDS-associated Kaposi’s sarcoma. J Med Virol. 2003;71:548–56. DOIPubMedGoogle Scholar
- Lacoste V, Judde JG, Briere J, Tulliez M, Garin B, Kassa-Kelembho E, Molecular epidemiology of human herpesvirus 8 in Africa: both B and A5 K1 genotypes, as well as the M and P genotypes of K14.1/K15 loci, are frequent and widespread. Virology. 2000;278:60–74. DOIPubMedGoogle Scholar
- Dukers NH, Rezza G. Human herpesvirus 8 epidemiology: what we do and do not know. AIDS. 2003;17:1717–30. DOIPubMedGoogle Scholar
1These authors contributed equally to this article.