Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 17, Number 5—May 2011

Dispatch

Rickettsia parkeri in Gulf Coast Ticks, Southeastern Virginia, USA

Chelsea L. Wright, Robyn M. Nadolny, Ju Jiang, Allen L. Richards, Daniel E. Sonenshine, Holly D. Gaff, and Wayne L. HynesComments to Author 
Author affiliations: Author affiliations: Old Dominion University, Norfolk, Virginia, USA (C.L. Wright, R. Nadolny, D.E. Sonenshine, H.D. Gaff, W.L. Hynes); Naval Medical Research Center, Silver Spring, Maryland, USA (J. Jiang, A.L. Richards)

Main Article

Table 1

Sequences of primers and probes used to test for Rickettsia spp. DNA in Amblyomma maculatum ticks collected from southeastern Virginia, April–September 2010*

Name Sequence, 5′ → 3′ Gene Fragment Reference
Rpa129F CAAATGTTGCAGTTCCTCTAAATG ompB 96 J. Jiang et al., unpub. data
Rpa224R AAAACAAACCGTTAAAACTACCG ompB 96 J. Jiang et al., unpub. data
Rpa188Probe
6-FAM-CGCGAAATTAATACCCTTATGAGCAGCAGTCGCG-BHQ-1
ompB
96
J. Jiang et al., unpub. data
R17K128F2 GGGCGGTATGAAYAAACAAG 17-kDa antigen gene 111 J. Jiang et al., unpub. data
R17K238R CCTACACCTACTCCVACAAG 17-kDa antigen gene 111 J. Jiang et al., unpub. data
R17K202TaqP
FAM-CCGAATTGAGAACCAAGTAATGC-TAMRA
17-kDa antigen gene
111
J. Jiang et al., unpub. data
190-FN1 AAGCAATACAACAAGGTC ompA 540 (1)
190-RN1
TGACAGTTATTATACCTC
ompA
540
(1)
RompB11F ACCATAGTAGCMAGTTTTGCAG ompB 1895 (9)
RompB1902R CCGTCATTTCCAATAACTAACTC ompB 1895 (9)

*omp, outer membrane protein gene.

Main Article

References
  1. Paddock  CD, Sumner  JW, Comer  JA, Zaki  SR, Goldsmith  CS, Goddard  J, Rickettsia parkeri: a newly recognized cause of spotted fever rickettsiosis in the United States. Clin Infect Dis. 2004;38:80511. DOIPubMedGoogle Scholar
  2. Paddock  CD, Fournier  PE, Sumner  JW, Goddard  J, Elshenawy  Y, Metcalfe  MG, Isolation of Rickettsia parkeri and identification of a novel spotted fever group Rickettsia sp. from Gulf Coast ticks (Amblyomma maculatum) in the United States. Appl Environ Microbiol. 2010;76:268996. DOIPubMedGoogle Scholar
  3. Whitman  TJ, Richards  AL, Paddock  CD, Tamminga  CL, Sniezek  PJ, Jiang  J, Rickettsia parkeri infection after tick bite, Virginia. Emerg Infect Dis. 2007;13:3346. DOIPubMedGoogle Scholar
  4. Merten  HA, Durden  LA. A state-by-state survey of ticks recorded from humans in the United States. J Vector Ecol. 2000;25:10213.PubMedGoogle Scholar
  5. Goddard  J, Norment  B. Notes on the geographical distribution of the Gulf Coast tick, Amblyomma maculatum (Koch) [Acari: Ixodidae]. Entomological News (USA). 1983;94:1034.
  6. Levine  JF, Sonenshine  DE, Nicholson  WL, Turner  RT. Borrelia burgdorferi in ticks (Acari: Ixodidae) from coastal Virginia. J Med Entomol. 1991;28:66874.PubMedGoogle Scholar
  7. Sonenshine  D, Lamb  J Jr, Anastos  G. The distribution, hosts and seasonal activity of Virginia ticks. Va J Sci. 1965;16:2691.
  8. Sonenshine  DE, Ratzlaff  RE, Troyer  J, Demmerle  S, Demmerle  ER, Austin  WE, Borrelia burgdorferi in eastern Virginia: comparison between a coastal and inland locality. Am J Trop Med Hyg. 1995;53:12333.PubMedGoogle Scholar
  9. Jiang  J, Blair  PJ, Felices  V, Moron  C, Cespedes  M, Anaya  E, Phylogenetic analysis of a novel molecular isolate of spotted fever group Rickettsiae from northern Peru: Candidatus Rickettsia andeanae. Ann N Y Acad Sci. 2005;1063:33742. DOIPubMedGoogle Scholar
  10. Scifres  C, Oldham  T, Teel  P, Drawe  D. Gulf coast tick (Amblyomma maculatum) populations and responses to burning of coastal prairie habitats. Southwest Nat. 1988;33:5564. DOIGoogle Scholar
  11. Barker  RW, Kocan  AA, Ewing  SA, Wettemann  RP, Payton  ME. Occurrence of the Gulf Coast tick (Acari: Ixodidae) on wild and domestic mammals in north-central Oklahoma. J Med Entomol. 2004;41:1708. DOIPubMedGoogle Scholar
  12. Sumner  JW, Durden  LA, Goddard  J, Stromdahl  EY, Clark  KL, Reeves  WK, Gulf Coast ticks (Amblyomma maculatum) and Rickettsia parkeri, United States. Emerg Infect Dis. 2007;13:7513.PubMedGoogle Scholar
  13. Cohen  SB, Yabsley  MJ, Garrison  LE, Freye  JD, Dunlap  BG, Dunn  JR, Rickettsia parkeri in Amblyomma americanum ticks, Tennessee and Georgia, USA. Emerg Infect Dis. 2009;15:14713. DOIPubMedGoogle Scholar
  14. Trout  R, Steelman  CD, Szalanski  AL, Williamson  PC. Rickettsiae in Gulf Coast ticks, Arkansas, USA. Emerg Infect Dis. 2010;16:8302.PubMedGoogle Scholar
  15. Goddard  J. Experimental infection of lone star ticks, Amblyomma americanum (L.), with Rickettsia parkeri and exposure of guinea pigs to the agent. J Med Entomol. 2003;40:6869. DOIPubMedGoogle Scholar

Main Article

Page created: August 14, 2011
Page updated: August 14, 2011
Page reviewed: August 14, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external