Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 18, Number 3—March 2012
Research

Causes of Pneumonia Epizootics among Bighorn Sheep, Western United States, 2008–2010

Thomas E. BesserComments to Author , Margaret A. Highland, Katherine Baker, E. Frances Cassirer, Neil J. Anderson, Jennifer M. Ramsey, Kristin Mansfield, Darren L. Bruning, Peregrine Wolff, Joshua B. Smith, and Jonathan A. Jenks
Author affiliations: Washington State University, Pullman, Washington, USA (T.E. Besser, M.A. Highland, K. Baker); Washington Animal Disease Diagnostic Laboratory, Pullman (T.E. Besser); US Department of Agriculture Agricultural Research Service, Pullman (M.A. Highland); Idaho Department of Fish and Game, Lewiston, Idaho, USA (E.F. Cassirer); Montana Fish, Wildlife and Parks, Bozeman, Montana, USA (N.J. Anderson, J.M. Ramsey); Washington Department of Fish and Wildlife, Spokane Valley, Washington, USA (K. Mansfield); US Department of Agriculture Animal and Plant Health Inspection Service, Olympia, Washington, USA (D.L. Bruning); Nevada Department of Wildlife, Reno, Nevada, USA (P. Wolff); South Dakota State University, Brookings, South Dakota, USA (J.B. Smith, J.A. Jenks)

Main Article

Table 2

PCR primers used to detect etiologic agents of pneumonia in bighorn sheep, western United States, 2008–2010

Species (gene target) Primer Primer sequence, 5′ → 3′ Reference
Mannheimia haemolytica, Bibersteinia
trehalosi, M. haemolytica (gcp) Mhgcp AGAGGCCAATCTGCAAACCTCG (21)
MhgcpR GTTCGTATTGCCCAACGCCG (21)
Bibersteinia trehalosi (sodA) BtsodAF GCCTGCGGACAAACGTGTTG (21)
BtsodAR TTTCAACAGAACCAAAATCACGAATG (21)
Leukotoxin (lktA) F TGTGGATGCGTTTGAAGAAGG (26)
R ACTTGCTTTGAGGTGATCCG (26)
Pasteurella multocida (kmt1) KMT1T7 ATCCGCTATTTACCCAGTGG (27)
KMT1SP6 GCTGTAAACGAACTCGCCAC (27)
Mycoplasma ovipneumoniae (16S) LMF TGAACGGAATATGTTAGCTT (28)
LMR GACTTCATCCTGCACTCTGT (28)
M. ovipneumoniae (16S–23S intergenic spacer) MoIGSF GGAACACCTCCTTTCTACGG This study
MoIGSR CCAAGGCATCCACCAAATAC This study

Main Article

References
  1. Cassirer  EF, Sinclair  ARE. Dynamics of pneumonia in a bighorn sheep metapopulation. J Wildl Manage. 2007;71:1080–8. DOIGoogle Scholar
  2. Hobbs  NT, Miller  MW. Interactions between pathogens and hosts: simulation of pasteurellosis epidemics in bighorn sheep populations. In: McCullough DR, Barrett RH, editors. Wildlife 2001: populations. New York: Springer Publishing Company; 1992. p. 997–1007.
  3. McCarty  CW, Miller  MW. Modeling the population dynamics of bighorn sheep: a synthesis of literature. Colorado Division of Wildlife special report 73. Denver: Colorado Division of Wildlife; 1998.
  4. Monello  RJ, Murray  DL, Cassirer  EF. Ecological correlates of pneumonia epizootics in bighorn sheep herds. Can J Zool. 2001;79:1423–32. DOIGoogle Scholar
  5. Miller  MW. Pasteurellosis. In: Williams ES, Barker IK, editors. Infectious diseases of wild mammals. Ames (IA): Iowa State University Press; 2001. p. 558.
  6. George  JL, Martin  DJ, Lukacs  PM, Miller  MW. Epidemic pasteurellosis in a bighorn sheep population coinciding with the appearance of a domestic sheep. J Wildl Dis. 2008;44:388–403.PubMedGoogle Scholar
  7. Festa-Bianchet  M. A pneumonia epizootic in bighorn sheep, with comments on preventive management. In: Samuel WM, editor. Proceedings of the Sixth Biennial Symposium of the Northern Wild Sheep and Goat Council. 1988 Apr 11–15; Banff, Alberta, Canada. Cody (WY): The Council; 1988. p. 66–76.
  8. Spraker  TR, Hibler  CP, Schoonveld  GG, Adney  WS. Pathologic changes and microorganisms found in bighorn sheep during a stress-related die-off. J Wildl Dis. 1984;20:319–27.PubMedGoogle Scholar
  9. Monello  RJ, Murray  DL, Cassirer  EF. Ecological correlates of pneumonia epizootics in bighorn sheep herds. Can J Zool. 2001;79:1423–32. DOIGoogle Scholar
  10. Ryder  TJ, Mills  KW, Bowles  KH, Thorne  ET. Effect of pneumonia on population size and lamb recruitment in Whiskey Mountain bighorn sheep. In: Proceedings of the Eighth Biennial Symposium of the Northern Wild Sheep and Goat Council; 1992 Apr 27–May 1; Cody, Wyoming, USA. Cody (WY): The Council; 1992. p.136–46.
  11. Rudolph  KM, Hunter  DL, Rimler  RB, Cassirer  EF, Foreyt  WJ, DeLong  WJ, Microorganisms associated with a pneumonic epizootic in Rocky Mountain bighorn sheep (Ovis canadensis canadensis). J Zoo Wildl Med. 2007;38:548–58. DOIPubMedGoogle Scholar
  12. Aune  KA, Anderson  N, Worley  D, Stackhouse  L, Henderson  J, Daniel  J. A comparison of population and health histories among seven bighorn sheep populations. Proceedings of the Eleventh Biennial Symposium of the Northern Wild Sheep and Goat Council. 1998 Apr 16–20; Whitefish, Montana, USA; 1998. Cody (WY): The Council; 1998; p.:46–69.
  13. Clark  RK, Jessup  DA, Kock  MD, Weaver  RA. Survey of desert bighorn sheep in California for exposure to selected infectious diseases. J Am Vet Med Assoc. 1985;187:1175–9.PubMedGoogle Scholar
  14. Foreyt  WJ. Fatal Pasteurella haemolytica pneumonia in bighorn sheep after direct contact with clinically normal domestic sheep. Am J Vet Res. 1989;50:341–4.PubMedGoogle Scholar
  15. Weiser  GC, DeLong  WJ, Paz  JL, Shafii  B, Price  WJ, Ward  ACS. Characterization of Pasteurella multocida associated with pneumonia in bighorn sheep. J Wildl Dis. 2003;39:536–44.PubMedGoogle Scholar
  16. Wolfe  LL, Diamond  B, Spraker  TR, Sirochman  MA, Walsh  DP, Machin  CM, A bighorn sheep die-off in southern Colorado involving a Pasteurellaceae strain that may have originated from syntopic cattle. J Wildl Dis. 2010;46:1262–8.PubMedGoogle Scholar
  17. Besser  TE, Cassirer  EF, Potter  KA, VanderSchalie  J, Fischer  A, Knowles  DP, Association of Mycoplasma ovipneumoniae infection with population-limiting respiratory disease in free-ranging Rocky Mountain bighorn sheep (Ovis canadensis canadensis). J Clin Microbiol. 2008;46:423–30. DOIPubMedGoogle Scholar
  18. Dassanayake  RP, Shanthalingam  S, Herndon  CN, Subramaniam  R, Lawrence  PK, Bavananthasivam  J, Mycoplasma ovipneumoniae can predispose bighorn sheep to fatal Mannheimia haemolytica pneumonia. Vet Microbiol. 2010;145:354–9. DOIPubMedGoogle Scholar
  19. Besser  TE, Cassirer  EF, Yamada  C, Potter  KA, Herndon  C, Foreyt  WJ, Survival of bighorn sheep (Ovis canadensis) commingled with domestic sheep (Ovis aries) in the absence of Mycoplasma ovipneumoniae. J Wildl Dis. 2012;48:168–72.PubMedGoogle Scholar
  20. Weiser  GC, Drew  ML, Cassirer  EF, Ward  AC. Detection of Mycoplasma ovipneumoniae in bighorn sheep using enrichment culture coupled with genus- and species-specific polymerase chain reaction. J Wildl Dis. 2012. In press.
  21. Dassanayake  RP, Call  DR, Sawant  AA, Casavant  NC, Weiser  GC, Knowles  DP, Bibersteinia trehalosi inhibits the growth of Mannheimia haemolytica by a proximity-dependent mechanism. Appl Environ Microbiol. 2010;76:1008–13. DOIPubMedGoogle Scholar
  22. Fredericks  DN, Relman  DA. Sequence-based identification of microbial pathogens: a reconsideration of Koch's postulates. Clin Microbiol Rev. 1996;9:18–33.PubMedGoogle Scholar
  23. Gilbert  GL. Molecular diagnostics in infectious diseases and public health microbiology: cottage industry to postgenomics. Trends Mol Med. 2002;8:280–7. DOIPubMedGoogle Scholar
  24. Riley  LW. Molecular epidemiology of infectious diseases: principles and practices. Washington: ASM Press; 2004.
  25. Quinn  PJ, Markey  BK, Leonard  FC, FitzPatrick  ES, Fanning  S, Hartigan  PJ. Veterinary microbiology and microbial disease. 2nd ed. Chichester (UK): Wiley-Blackwell; 2011.
  26. Fisher  MA, Weiser  GC, Hunter  DL, Ward  ACS. Use of a polymerase chain reaction method to detect the leukotoxin gene IktA in biogroup and biovariant isolates of Pasteurella haemolytica and P. trehalosi. Am J Vet Res. 1999;60:1402–6.PubMedGoogle Scholar
  27. Townsend  KM, Frost  AJ, Lee  CW, Papadimitriou  JM, Dawkins  HJ. Development of PCR assays for species- and type-specific identification of Pasteurella multocida isolates. J Clin Microbiol. 1998;36:1096–100.PubMedGoogle Scholar
  28. McAuliffe  L, Hatchell  FM, Ayling  RD, King  AI, Nicholas  RA. Detection of Mycoplasma ovipneumoniae in Pasteurella-vaccinated sheep flocks with respiratory disease in England. Vet Rec. 2003;153:687–8. DOIPubMedGoogle Scholar
  29. Petti  CA. Detection and identification of microorganisms by gene amplification and sequencing. Clin Infect Dis. 2007;44:1108–14. DOIPubMedGoogle Scholar
  30. Kong  F, James  G, Gordon  S, Zelynski  A, Gilbert  GL. Species-specific PCR for identification of common contaminant mollicutes in cell culture. Appl Environ Microbiol. 2001;67:3195–200. DOIPubMedGoogle Scholar
  31. Cohen  J. Weighted kappa: nominal scale agreement with provision for scaled disagreement of partial credit. Psychol Bull. 1968;70:213–20. DOIPubMedGoogle Scholar
  32. Marascuilo  LA. Large-sample multiple comparisons. Psychol Bull. 1966;65:280–90. DOIPubMedGoogle Scholar
  33. Jeyaseelan  S, Sreevatsan  S, Maheswaran  SK. Role of Mannheimia haemolytica leukotoxin in the pathogenesis of bovine pneumonic pasteurellosis. Anim Health Res Rev. 2002;3:69–82. DOIPubMedGoogle Scholar
  34. Ward  ACS, Hunter  DL, Jaworski  MD, Benolkin  PJ, Dobel  MP, Jeffress  JB, Pasteurella spp. in sympatric bighorn and domestic sheep. J Wildl Dis. 1997;33:544–57.PubMedGoogle Scholar
  35. Jaworski  MD, Hunter  DL, Ward  ACS. Biovariants of isolates of Pasteurella from domestic and wild ruminants. J Vet Diagn Invest. 1998;10:49–55. DOIPubMedGoogle Scholar
  36. Sweeney  SJ, Silflow  RM, Foreyt  WJ. Comparative leukotoxicities of Pasteurella haemolytica isolates from domestic sheep and free-ranging bighorn sheep (Ovis canadensis). J Wildl Dis. 1994;30:523–8.PubMedGoogle Scholar
  37. Parham  K, Churchward  CP, McAuliffe  L, Nicholas  RA, Ayling  RD. A high level of strain variation within the Mycoplasma ovipneumoniae population of the UK has implications for disease diagnosis and management. Vet Microbiol. 2006;118:83–90. DOIPubMedGoogle Scholar
  38. Alley  MR, Ionas  G, Clarke  JK. Chronic non-progressive pneumonia of sheep in New Zealand–a review of the role of Mycoplasma ovipneumoniae. N Z Vet J. 1999;47:155–60. DOIPubMedGoogle Scholar
  39. Subramaniam  R, Herndon  CN, Shanthalingam  S, Dassanayake  RP, Bavananthasivam  J, Potter  KA, Defective bacterial clearance is responsible for the enhanced lung pathology characteristic of Mannheimia haemolytica pneumonia in bighorn sheep. Vet Microbiol. 2011;153:332–8. DOIPubMedGoogle Scholar
  40. Cassirer  EF, Oldenburg  LE, Coggins  V, Fowler  P, Rudolph  KM, Hunter  DL, Overview and preliminary analysis of Hells Canyon bighorn sheep die-off, 1995–6. Proceedings of the Tenth Biennial Symposium of the Northern Wild Sheep and Goat Council. 1996 Apr 29–May 3; Silverthorne, Colorado. Cody (WY): The Council; 1996;10:78–86.

Main Article

Page created: February 16, 2012
Page updated: February 16, 2012
Page reviewed: February 16, 2012
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external