Volume 18, Number 4—April 2012
Letter
Rickettsia monacensis as Cause of Mediterranean Spotted Fever–like Illness, Italy
Table
Selected inner primers used to amplify rickettsial gltA and ompA genes*
Rickettsial groups | Gene | Primer | Nucleotide sequence, 5′ → 3′ | Product size, bp | Reference |
---|---|---|---|---|---|
Rickettsiae spotted fever group plus typhus group | gtlA | gltA–F | TCGCAAATGTTCACGGTACTTT | 74 | (8) |
gltA–R | TCGTGCATTTCTTTCCATTGTG | ||||
Rickettsiae ompA | ompA | ompA–F | ATGGCGAATATTTCTCCAAAA | 632 | (9) |
ompA–R | GTTCCGTTAATGGCAGCATCT |
*gltA, citrate synthase; ompA, outer membrane protein A.
References
- Ciceroni L, Pinto A, Ciarrocchi S, Ciervo A. Current knowledge of rickettsial diseases in Italy. Ann N Y Acad Sci. 2006;1078:143–9.DOIGoogle Scholar
- Márquez FJ, Muniain MA, Soriguer RC, Izquierdo G, Rodríguez-Bano J, Borobio MV. Genotypic identification of an undescribed spotted fever group rickettsia in Ixodes ricinus from southwestern Spain. Am J Trop Med Hyg. 1998;58:570–7.
- Beninati T, Lo N, Noda H, Esposito F, Rizzoli A, Favia G, First detection of spotted fever group rickettsiae in Ixodes ricinus from Italy. Emerg Infect Dis. 2002;8:983–6.
- Simser JA, Palmer AT, Fingerle V, Wilske B, Kurtti TJ, Munderloh UG. Rickettsia monacensis sp. nov., a spotted fever group Rickettsia, from ticks (Ixodes ricinus) collected in a European city park. Appl Environ Microbiol. 2002;68:4559–66.DOIGoogle Scholar
- Sréter-Lancz Z, Sréter T, Széll Z, Egyed L. Molecular evidence of Rickettsia helvetica and R. monacensis infections in Ixodes ricinus from Hungary. Ann Trop Med Parasitol. 2005;99:325–30.DOIGoogle Scholar
- Chmielewski T, Podsiadly E, Karbowiak G, Tylewska-Wierzbanowska S. Rickettsia spp. in ticks, Poland. Emerg Infect Dis. 2009;15:486–8.DOIGoogle Scholar
- Jado I, Oteo JA, Aldámiz M, Gil H, Escudero R, Ibarra V, Rickettsia monacensis and human disease, Spain. Emerg Infect Dis. 2007;13:1405–7.
- Paris DH, Blacksell SD, Stenos J, Graves SR, Unsworth NB, Phetsouvanh R, Real-time multiplex PCR assay for detection and differentiation of rickettsiae and orientiae. Trans R Soc Trop Med Hyg. 2008;102:186–93.DOIGoogle Scholar
- Zhang L, Jin J, Fu X, Raoult D, Fournier PE. Genetic differentiation of Chinese isolates of Rickettsia sibirica by partial ompA gene sequencing and multispacer typing. J Clin Microbiol. 2006;44:2465–7.DOIGoogle Scholar
- Di Todaro N, Piazza C, Otranto D, Giangaspero A. Ticks infesting domestic animals in Italy: current acarological studies carried out in Sardinia and Basilicata regions. Parassitologia. 1999;41(Suppl 1):39–40.