Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 18, Number 5—May 2012

Research

Temporal Trends in Bordetella pertussis Populations, Denmark, 1949–2010

Randi Føns PetersenComments to Author , Tine Dalby, Ditte Marie Dragsted, Frits Mooi, and Lotte Lambertsen
Author affiliations: Statens Serum Institut, Copenhagen, Denmark (R.F. Petersen, T. Dalby, L. Lambertsen); private practitioner, Frederiksberg, Denmark (D.M. Dragsted); National Institute for Public Health and the Environment (RIVM), Bilthoven, the Netherlands (F. Mooi)

Main Article

Table 1

Primers used for MLVA and MASTdk typing in a study of temporal trends in Bordetella pertussis populations, Denmark, 1949–2009*

Primer name Target Sequence, 5′ → 3′ Reference
BP-VNTR1-DF VNTR1 FAM-CCTGGCGGCGGGAGACGTGGTGGTG (9)
BP-VNTR1-DR VNTR1 AAAATTGCGGCATGTGGGCTGACTCTGA (9)
BP-VNTR3-BF VNTR3 FAM -GCCTCGGCGAAATTGCTGAAC (9)
BP-VNTR3-BR VNTR3 GCGGGCGAGGAAACGCCCGAGACC (9)
BP-VNTR4-CF VNTR4 FAM-CGTGCCCTGCGCCTGGACCTG (9)
BP-VNTR4-BR VNTR4 GCCGCTGCTCGACGCCAGGGACAA (9)
BP-VNTR5-BF VNTR5 FAM-GAAGCCGGCCCACCCGAGCTCCAGGCTCTT (9)
BP-VNTR5-BR VNTR5 TGCCGGGTTTCGGCATCTCGATGGGATACG (9)
BP-VNTR6-EF VNTR6 FAM-CCAACGGCGGTCTGCTGGGTGGTC (9)
BP-VNTR6-FR VNTR6 AGGGCGCTGGTCACGCCACCGAGGAT (9)
BP-PtxP-F Pertussis toxin promoter AATCGTCCTGCTCAACCGCC (10)
BP-PtxP-R Pertussis toxin promoter GGTATACGGTGGCGGGAGGA (10)
BP-Ptx S1-F2 Pertussis toxin Subunit 1 CCCCCTGCCATGGTGTGATC (11,12)
BP-Ptx S1-R2 Pertussis toxin Subunit 1 AGAGCGTCTTGCGGTCGATC (11,12)
BP-prn-AF Pertactin region 1 GCCAATGTCACGGTCCAA (11–13)
BP-Prn-AR Pertactin region 1 GCAAGGTGATCGACAGGG (11–13)
BP-Prn-BF Pertactin region 2† AGCTGGGCGGTTCAAGGT (11–13)
BP-Prn-BR/ Pertactin region 2† CCGGATTCAGGCGCAACTC (11–13)
BP-tcfAF Tracheal colonization factor TTCTTGCGCGTCGTGTCTTC (9)
BP-tcfAR3 Tracheal colonization factor GCGGTTGCGGACCTTCAT (9)

*MLVA, multilocus variable-number tandem repeat analysis; MASTdk, multiple antigen sequence typing results obtained in Denmark; VNTR, variable-number tandem repeat.
†Pertactin region 2 was sequenced to confirm prn allele type (1 or 7).

Main Article

References
  1. Sekura  RD, Zhang  YL, Roberson  R, Acton  B, Trollfors  B, Tolson  N, Clinical, metabolic, and antibody responses of adult volunteers to an investigational vaccine composed of pertussis toxin inactivated by hydrogen peroxide. J Pediatr. 1988;113:806–13. DOIPubMedGoogle Scholar
  2. Sekura  RD, Fish  F, Manclark  CR, Meade  B, Zhang  YL. Pertussis toxin. Affinity purification of a new ADP-ribosyltransferase. J Biol Chem. 1983;258:14647–51.PubMedGoogle Scholar
  3. Statens Serum Institut. Vaccinationsdaekning [in Danish] [cited 2011 May 5]. http://www.ssi.dk/Vaccination/Vaccinationsdaekning.aspx
  4. Hviid  A, Stellfeld  M, Andersen  PH, Wohlfahrt  J, Melbye  M. Impact of routine vaccination with a pertussis toxoid vaccine in Denmark. Vaccine. 2004;22:3530–4. DOIPubMedGoogle Scholar
  5. Nielsen  A, Larsen  SO. Whooping cough epidemiology in Denmark prior to and after the introduction of whooping cough vaccination. Protective effect of the vaccine and herd immunity [in Danish]. Ugeskr Laeger. 1990;152:597–604.PubMedGoogle Scholar
  6. Dalby  T, Christensen  JJ. Whooping cough 2008. EPI-NEWS. 2009; 44 [cited 2011 May 5]. http://www.ssi.dk/English/News/EPI-NEWS/~/media/Indhold/EN%20-%20engelsk/EPI-NEWS/2009/pdf/EPI-NEWS%20-%202009%20-%20No%2044.ashx
  7. Knudsen  LK, Andersen  PH. Whooping cough in children <2 years. EPI-NEWS. 2011; 42–43 [cited 2011 May 5]. http://www.ssi.dk/English/News/EPI-NEWS/2011/No%2042-43%20-%202011.aspx
  8. Kaltoft  MS, Madsen  J, Jarløv  JO, Jensen  TG, Prag  J. Laboratory diagnosed whooping cough 2002–2004. EPI-NEWS. 2005;46 [cited 2011 May 5]. http://www.ssi.dk/English/News/EPI-NEWS/~/media/Indhold/EN%20-%20engelsk/EPI-NEWS/2005/PDF/EPI-NEWS%20-%202005%20-%20No%2046.ashx
  9. Schouls  LM, van der Heide  HG, Vauterin  L, Vauterin  P, Mooi  FR. Multiple-locus variable-number tandem repeat analysis of Dutch Bordetella pertussis strains reveals rapid genetic changes with clonal expansion during the late 1990s. J Bacteriol. 2004;186:5496–505. DOIPubMedGoogle Scholar
  10. Mooi  FR, van Loo  IHM, van Gent  M, He  Q, Bart  MJ, Heuvelman  KJ, Bordetella pertussis strains with increased toxin production associated with pertussis resurgence. Emerg Infect Dis. 2009;15:1206–13. DOIPubMedGoogle Scholar
  11. van Loo  IHM, Heuvelman  KJ, King  AJ, Mooi  FR. Multilocus sequence typing of Bordetella pertussis based on surface protein genes. J Clin Microbiol. 2002;40:1994–2001. DOIPubMedGoogle Scholar
  12. Mooi  FR, van Oirschot  H, Heuvelman  K, van der Heide  HG, Gaastra  W, Willems  RJ. Polymorphism in the Bordetella pertussis virulence factors P.69/pertactin and pertussis toxin in the Netherlands: temporal trends and evidence for vaccine-driven evolution. Infect Immun. 1998;66:670–5.PubMedGoogle Scholar
  13. King  AJ, Berbers  G, van Oirschot  HF, Hoogerhout  P, Knipping  K, Mooi  FR. Role of the polymorphic region 1 of the Bordetella pertussis protein pertactin in immunity. Microbiology. 2001;147:2885–95.PubMedGoogle Scholar
  14. Kurniawan  J, Maharjan  RP, Chan  WF, Reeves  PR, Sintchenko  V, Gilbert  GL, Bordetella pertussis clones identified by multilocus variable-number tandem-repeat analysis. Emerg Infect Dis. 2010;16:297–300.PubMedGoogle Scholar
  15. National Institute for Public Health and the Environment. MLVA: Bordetella pertussis [cited 2011 Feb 2]. http://www.mlva.net/bpertussis/default.asp
  16. Litt  DJ, Neal  SE, Fry  NK. Changes in genetic diversity of the Bordetella pertussis population in the United Kingdom between 1920 and 2006 reflect vaccination coverage and emergence of a single dominant clonal type. J Clin Microbiol. 2009;47:680–8. DOIPubMedGoogle Scholar
  17. Mooi  FR. Bordetella pertussis and vaccination: the persistence of a genetically monomorphic pathogen. Infect Genet Evol. 2010;10:36–49. DOIPubMedGoogle Scholar
  18. Advani  A, Gustafsson  L, Ahren  C, Mooi  FR, Hallander  HO. Appearance of Fim3 and ptxP3-Bordetella pertussis strains, in two regions of Sweden with different vaccination programs. Vaccine. 2011;29:3438–42. DOIPubMedGoogle Scholar
  19. Mooi  FR, He  Q, van Oirschot  H, Mertsola  J. Variation in the Bordetella pertussis virulence factors pertussis toxin and pertactin in vaccine strains and clinical isolates in Finland. Infect Immun. 1999;67:3133–4.PubMedGoogle Scholar
  20. Caro  V, Elomaa  A, Brun  D, Mertsola  J, He  Q, Guiso  N. Bordetella pertussis, Finland and France. Emerg Infect Dis. 2006;12:987–9. DOIPubMedGoogle Scholar
  21. van Amersfoorth  SC, Schouls  LM, van der Heide  HG, Advani  A, Hallander  HO, Bondeson  K, Analysis of Bordetella pertussis populations in European countries with different vaccination policies. J Clin Microbiol. 2005;43:2837–43. DOIPubMedGoogle Scholar
  22. Advani  A, van der Heide  HG, Hallander  HO, Mooi  FR. Analysis of Swedish Bordetella pertussis isolates with three typing methods: characterization of an epidemic lineage. J Microbiol Methods. 2009;78:297–301. DOIPubMedGoogle Scholar
  23. King  AJ, van Gorkom  T, Pennings  JL, van der Heide  HG, He  Q, Diavatopoulos  D, Comparative genomic profiling of Dutch clinical Bordetella pertussis isolates using DNA microarrays: identification of genes absent from epidemic strains. BMC Genomics. 2008;9:311. DOIPubMedGoogle Scholar

Main Article

Page created: April 12, 2012
Page updated: April 12, 2012
Page reviewed: April 12, 2012
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external