Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 19, Number 11—November 2013
Dispatch

Middle East Respiratory Syndrome Coronavirus in Bats, Saudi Arabia

Ziad A. Memish, Nischay Mishra, Kevin J. Olival, Shamsudeen F. Fagbo, Vishal Kapoor, Jonathan H. Epstein, Rafat AlHakeem, Abdulkareem Durosinloun, Mushabab Al Asmari, Ariful Islam, Amit Kapoor, Thomas Briese, Peter Daszak, Abdullah A. Al Rabeeah, and W. Ian LipkinComments to Author 
Author affiliations: Ministry of Health, Riyadh, Saudi Arabia (Z.A. Memish, S.F. Fagbo, R. AlHakeem, A. Durosinloun, A.A. Al Rabeeah); Columbia University, New York, New York, USA (N. Mishra, V. Kapoor, A. Kapoor, T. Briese, W.I. Lipkin); EcoHealth Alliance, New York (K.J. Olival, J.H. Epstein, P. Daszak); Ministry of Health, Bisha, Saudi Arabia (M. Al Asmari); EcoHealth Alliance, Dhaka, Bangladesh (A. Islam)

Main Article

Table 1

PCRs and primers used in CoV detection*

PCRs (reference) Primers, 5′→3′ Nested fragment size, region (primer locations on the reference) genome)† Type of CoV (no.)
Nested pan-CoV-I (6) PLQ-F1, CGTTGGIACWAAYBTVCCWYTICARBTRGG ≈400 nt, RdRp (18310–187450) α-CoV (8), β-CoV (1)
PLQ-R1, GGTCATKATAGCRTCAVMASWWGCNACATG
PLQ-F2, GGCWCCWCCHGGNGARCAATT
PLQ-R2, GGWAWCCCCAYTGYTGWAYRTC
Nested pan-CoV-II (7) WT-COV-F1, GGTTGGGAYTAYCCHAARTGTGA ≈430 nt, RdRp (15260–15700) α-CoV (5), β-CoV (2)
WT-COV-R1, CCATCATCASWYRAATCATCATA
WT-COV-F2, GAYTAYCCHAARTGTGAYAGAGC
WT-COV-F3, GAYTAYCCHAARTGTGAUMGWGC
Hemi-nested RdRp-sequence assay (9) EMC-SeqRdRP-Rev, GCATWGCNCWGTCACACTTAGG ≈230 nt, RdRp (15048–15290) α-CoV (2), β-CoV (1)
EMC-SeqRdRP-Fwd, TGCTATWAGTGCTAAGAATAGRGC
EMC-SeqRdRP-Rnest, CACTTAGGRTARTCCCAWCCCA
Hemi-nested N-sequence assay (9) EMC-SeqN-Fwd, CCTTCGGTACAGTGGAGCCA ≈280 nt,N seq (29,549–29,860)
EMC-SeqN-Rev, GATGGGGTTGCCAAACACAAAC
EMC-SeqN-Fnest, TGACCCAAAGAATCCCAACTAC
Nested CII-pan-CoV-III NM-CoV-2F1, ACWGTTCARGGICCWCCIGG ≈355 nt, helicase (17,060–17,410) β-CoV (2)
NM-CoV-2F2, GTTCARGGGCCWCCGGGNAC
NM-CoV-2R1, GGCAGCTGWGCWGGRTCICCNACRTA
NM-CoV-2R2, AGCTGWGCWGGRTCGCCIACRTANAC
Nested CII-MERS-RdRp NM-HCOV-F1, GTGCTAAGAATAGAGCTCGCACT
NM-HCOV-F2, AGAGCTCGCACTGTTGCAGGC ≈190 nt, RdRp (15068–15249) β-CoV (1, MERS CoV)
NM-HCOV-F2, AGAGCTCGCACTGTTGCAGGC
NM-HCOV-R1, ACCCATAAGATGCGGATTATCAAC
NM-HCOV-R2, TGCGGATTATCAACATCTTTGTAC
Hemi-nested CII-MERS N sequence NM-NSeq-F-1, ACTTCCTTCGGTACAGTGGAGC ≈170 nt, N seq (29545–29713)
NM-NSeq-R-1, GGCACTGTTCACTTGCAATC
NM-NSeq-R-2, GGAGGTTCAGACATTTGGTCT
upE and ORF1b real-time assays (8) upE-Fwd: GCAACGCGCGATTCAGTT Upstream of E gene and ORF 1b
upE-Prb: FAM-CTCTTCACATAATCGCCCCGAGCTCG-TAMRA
upE-Rev: GCCTCTACACGGGACCCATA
ORF1b-Fwd: TTCGATGTTGAGGGTGCTCAT
ORF1b-Prb: FAM-CCCGTAATGCATGTGGCACCAATGT-TAMRA
ORF1b-Rev: TCACACCAGTTGAAAATCCTAATTG

* CoV, coronavirus; MERS, Middle East respiratory syndrome; RdRp, RNA-dependent RNA polymerase; –, not applicable; ORF, open reading frame.
†Primer locations are based on human β-CoV 2c EMC/2012, complete genome (GenBank accession no. JX869059).

Main Article

References
  1. Zaki  AM, van Boheemen  S, Bestebroer  TM, Osterhaus  AD, Fouchier  RA. Isolation of a novel coronavirus from a man with pneumonia in Saudi Arabia. N Engl J Med. 2012;367:181420 . DOIPubMed
  2. Assiri  A, McGeer  A, Perl  TM, Price  CS, Al Rabeeah  AA, Cummings  DA, Hospital outbreak of Middle East respiratory syndrome coronavirus. N Engl J Med. 2013;369:40716. DOIPubMed
  3. Annan  A, Baldwin  HJ, Corman  VM, Klose  SM, Owusu  M, Nkrumah  EE, Human betacoronavirus 2c EMC/2012-related viruses in bats, Ghana and Europe. Emerg Infect Dis. 2013;19:4569. DOIPubMed
  4. Anthony  SJ, Ojeda-Flores  R, Rico-Chavez  O, Navarrete-Macias  I, Zambrana-Torrelio  CM, Rostal  MK, Coronaviruses in bats from Mexico. J Gen Virol. 2013;94:102838. DOIPubMed
  5. Ithlete  NL, Stoffberg  S, Corman  VM, Cottontail  VM, Richards  LR, Schoeman  MC, Close relative of human Middle East respiratory syndrome coronavirus in bat, South Africa [letter]. Emerg Infect Dis. 2013:19 [cited 2013 Aug 19]. http://wwwnc.cdc.gov/eid/article/19/10/13-0946_article.htm
  6. Quan  PL, Firth  C, Street  C, Henriquez  JA, Petrosov  A, Tashmukhamedova  A, Identification of a severe acute respiratory syndrome coronavirus–like virus in a leaf-nosed bat in Nigeria. MBio. 2010;1:e0020810 .DOIPubMed
  7. Watanabe  S, Masangkay  JS, Nagata  N, Morikawa  S, Mizutani  T, Fukushi  S, Bat coronaviruses and experimental infection of bats, the Philippines. Emerg Infect Dis. 2010;16:121723. DOIPubMed
  8. Corman  VM, Eckerle  I, Bleicker  T, Zaki  A, Landt  O, Eschbach-Bludau  M, Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction. Euro Surveill. 2012;17:20288.PubMed
  9. Corman  VM, Muller  MA, Costabel  U, Timm  J, Binger  T, Meyer  B, Assays for laboratory confirmation of novel human coronavirus (hCoV-EMC) infections. Euro Surveill. 2012;17:20334.PubMed
  10. Teeling  EC, Springer  MS, Madsen  O, Bates  P, O'Brien  SJ, Murphy  WJ. A molecular phylogeny for bats illuminates biogeography and the fossil record. Science. 2005;307:5804. DOIPubMed
  11. Smith  I, Wang  LF. Bats and their virome: an important source of emerging viruses capable of infecting humans. Curr Opin Virol. 2013;3:8491 .DOIPubMed
  12. Lau  SK, Woo  PC, Li  KS, Huang  Y, Tsoi  HW, Wong  BH, Severe acute respiratory syndrome coronavirus–like virus in Chinese horseshoe bats. Proc Natl Acad Sci U S A. 2005;102:140405. DOIPubMed
  13. Poon  LL, Chu  DK, Chan  KH, Wong  OK, Ellis  TM, Leung  YH, Identification of a novel coronavirus in bats. J Virol. 2005;79:20019. DOIPubMed
  14. Li  W, Shi  Z, Yu  M, Ren  W, Smith  C, Epstein  JH, Bats are natural reservoirs of SARS-like coronaviruses. Science. 2005;310:6769. DOIPubMed
  15. Khan  SU, Gurley  ES, Hossain  MJ, Nahar  N, Sharker  MA, Luby  SP. A randomized controlled trial of interventions to impede date palm sap contamination by bats to prevent Nipah virus transmission in Bangladesh. PLoS ONE. 2012;7:e42689. DOIPubMed

Main Article

Page created: August 23, 2013
Page updated: August 23, 2013
Page reviewed: August 23, 2013
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external