Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 19, Number 7—July 2013

Dispatch

Novel Bartonella Agent as Cause of Verruga Peruana

David L. BlazesComments to Author , Kristin Mullins, Bonnie L. Smoak, Ju Jiang, Enrique Canal, Nelson Solorzano, Eric Hall, Rina Meza, Ciro Maguina, Todd Myers, Allen L. Richards, and Larry Laughlin
Author affiliations: Uniformed Services University of the Health Sciences, Bethesda, Maryland, USA (D.L. Blazes, K. Mullins, B.L. Smoak, L. Laughlin); Walter Reed Army Institute of Research, Silver Spring, Maryland, USA (B.L. Smoak); Naval Medical Research Center, Silver Spring (J. Jiang, E. Hall, T. Myers, A.L. Richards); Naval Medical Research Unit 6, Lima, Peru (E. Canal, R. Meza); Hospital San Juan de Dios, Lima (N. Solorzano); Universidad Peruana Cayetano Heredia–Tropicales, Lima (C. Maguina)

Main Article

Table

Primers used for PCR, nested PCR, and sequencing of novel Bartonella isolate from Peru, 2011–2012*

Gene Primer name Primer sequence, 5’ → 3’ Use Fragment length
rrs 16SU17F AGAGTTTGATCCTGGCTCAG PCR, nPCR, sequencing 1,424 bp
16SU1592R AGGAGGTRATCCAGCCGCA PCR, nPCR, sequencing
16SU 833R CTACCAGGGTATCTAATCCTGTT nPCR, sequencing

16S E. coli-518F
CAGCAGCCGCGGTAATAC
nPCR, sequencing

gltA† BHCS 781p (F) GGGACCAGCTCATGGTGG PCR, sequencing 338 bp

BHCS 1137n (R)
AATGCAAAAAGAACAGTAAACA
PCR, sequencing

rpoB BrpoB1435F CGCATTGGTTTRCTTCGTATG PCR 589 bp
Brpo2327R GTAGACTGATTAGAACGCTG PCR, nPCR, sequencing
Brpo1696F CCTACGCATTATGGTCGTATTTG nPCR, sequencing

*nPCR, nested PCR.
†gltA primers were previously described by Eremeeva et al. (4).

Main Article

References
  1. Schultz  MG. A history of bartonellosis (Carrion’s disease). Am J Trop Med Hyg. 1968;17:503–15 .PubMedGoogle Scholar
  2. Maguina  C, Garcia  PJ, Gotuzzo  E, Cordero  L, Spach  DH. Bartonellosis (Carrion’s disease) in the modern era. Clin Infect Dis. 2001;33:772–9. DOIPubMedGoogle Scholar
  3. Chamberlin  J, Laughlin  LW, Romero  S, Solórzano  N, Gordon  S, Andre  RG, Epidemiology of endemic Bartonella bacilliformis: a prospective cohort study in a Peruvian mountain valley community. J Infect Dis. 2002;186:983–90 and. DOIPubMedGoogle Scholar
  4. Eremeeva  ME, Gerns  HL, Lydy  SL, Goo  JS, Ryan  ET, Mathew  SS, Bacteremia, fever, and splenomegaly caused by a newly recognized Bartonella species. N Engl J Med. 2007;356:2381–7 and. DOIPubMedGoogle Scholar
  5. Mallqui  V, Speelmon  EC, Verástegui  M, Maguiña-Vargas  C, Pinell-Sallis  P, Sonicated diagnostic immunoblot for bartonellosis. Clin Diagn Lab Immunol. 2000;7:1–5 .PubMedGoogle Scholar
  6. Walker  TS, Winkler  HH. Bartonella bacilliformis: colonial types and erythrocyte adherence. Infect Immun. 1981;31:480–6 .PubMedGoogle Scholar
  7. Maass  M, Schreiber  M, Knobloch  J. Detection of Bartonella bacilliformis in cultures, blood, and formalin preserved skin biopsies by use of the polymerase chain reaction. Trop Med Parasitol. 1992;43:191–4 .PubMedGoogle Scholar
  8. Rolain  JM, Brouqui  P, Koehler  JE, Maguina  C, Dolan  MJ, Raoult  D. Recommendations for treatment of human infections caused by Bartonella species. Antimicrob Agents Chemother. 2004;48:1921–33. DOIPubMedGoogle Scholar
  9. Arroyo  A. Treatment outlines for non-complicated Carrion’s disease, in Caraz, Peru. Anales de la Facultad de Medecina. 2008;69:7–11.
  10. Maass  M, Schreiber  M, Knobloch  J. Detection of Bartonella bacilliformis in cultures, blood, and formalin preserved skin biopsies by use of the polymerase chain reaction. Trop Med Parasitol. 1992;43:191–4 .PubMedGoogle Scholar
  11. Tamura  K, Peterson  D, Peterson  N, Stecher  G, Nei  M, Kumar  S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 2011;28:2731–9. DOIPubMedGoogle Scholar
  12. Zeaiter  Z, Liang  Z, Raoult  D. Genetic classification and differentiation of Bartonella species based on comparison of partial ftsZ gene sequence. J Clin Microbiol. 2002;40:3641–7. DOIPubMedGoogle Scholar
  13. La Scola  B, Zeaiter  Z, Khamis  A, Raoult  D. Gene-sequence-based criteria for species definition in bacteriology: the Bartonella paradigm. Trends Microbiol. 2003;11:318–21. DOIPubMedGoogle Scholar
  14. Jones  KE, Patel  NG, Levy  MA, Storeygard  A, Balk  D, Gittleman  JL, Global trends in emerging infectious diseases. Nature. 2008;451:990–3 . DOIPubMedGoogle Scholar
  15. Sanchez Clemente  N, Ugarte-Gil  CA, Solórzano  N, Maguiña  C, Pachas  P, Bartonella bacilliformis: a systematic review of the literature to guide the research agenda for elimination. PLoS Negl Trop Dis. 2012;6:e1819.

Main Article

Page created: June 18, 2013
Page updated: June 18, 2013
Page reviewed: June 18, 2013
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external