Volume 20, Number 4—April 2014
Dispatch
Complete Genome of Hepatitis E Virus from Laboratory Ferrets
Table 1
Oligonucleotides used to amplify ferret hepatitis E viruses
| Primer (nucleotide positions)* | Sequence, 5′→3′ | Product length, bp† |
|---|---|---|
| Forward FF1 (1–21) | GGCAGACCCCTAATGGAGACA | |
| Reverse FR628 (628–648) | GTTGCGTGCGACATAGGCCTT | 626 |
| Forward FF541 (541–561) | AGCAATGTATCGCCATGGCAT | |
| Reverse FR1535 (1535–1554) | ATCTGCATCAGTCGGGCACA | 1,014 |
| Forward FF1518 (1518–1538) | AGGATCTGACAGTAGACCTGT | |
| Reverse FR2555 (2555–2577) | TGCAATGCCAAATTAGCTGTGT | 1,060 |
| Forward FF2401 (2401–2421) | GGCGATGAGTTGTACCTGTTA | |
| Reverse FR3424 (3432–3445) | GAGCAGCCGGTAACATACTCAA | 1,045 |
| Forward FF3336 (3336–3355) | GCACAATTTCTATCTCACCA | |
| Reverse FR4210 (4210–4230) | ACTCCGAATCAGATGATACA | 985 |
| Forward FF4181 (4181–4202) | GGCTGGTGCACCTGAATGGCT | |
| Reverse FR5800 (5800–5821) | TCAGGCAGACGGCGTATCTTAT | 1,641 |
| Forward FF4812 (4812–4831) | ATGGAGCATGTGTACAAGAT | |
| Reverse TX30SXN | GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT | ≈2,050 |
| Reverse FR451‡ | ACACCGTGTGAATCCCTCCGT | |
| Abridged amplification | GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG | |
| Reverse FR279 (279–300) | ATAGATCTAGGATGCGCACCAA | § |
| Abridged universal amplification | GGCCACGCGTCGACTAGTAC | |
| Reverse FR191 (191–211) | CGGATGCGACCAAACAACAGA | ≈240 |
*Values in parentheses indicate positions of the primer corresponding to the entire genome of hepatitis E virus (JN998607) isolated from ferret.
†Blank cell indicates that 1 primer pair produced 1 product.
‡Used only for cDNA synthesis.
§PCR product was not detected.
Page created: March 18, 2014
Page updated: March 18, 2014
Page reviewed: March 18, 2014
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.