Volume 21, Number 3—March 2015
Dispatch
Noninvasive Test for Tuberculosis Detection among Primates
Table 2
Fecal IS6110 conventional and real-time PCR master mixes and reaction conditions for investigation of noninvasive tuberculosis detection in primates
| PCR type | Primers, 5′ → 3′ | Master mix | Reaction conditions |
|---|---|---|---|
| Conventional |
Forward: TTCAGGTCGAGTACGCCTTC Reverse: CGAACTCAAGGAGCACATCA |
12.5 μL HotStarTaq Master Mix:* 8 μL RNase-free water,* 0.4 μM of each primer, 1.25 μL DMSO, 0.25 μL 1% BSA, 1 μL DNA template. Total volume 25 μL |
95°C for 15 min/DNA polymerase activation; 40 cycles: 94°C for 30 s/denaturation, 56°C for 30 s/annealing, 72°C for 1 min/extension. Termination at 72°C for 10 min |
| Real-time | Forward: AGAAGGCGTACTCGACCTGA Reverse: CCGGATCGATGTGTACTGAG | LightCycler 480 Probes Master:† 0.2 mM of each primer, 0.2 mM of the FAM-labeled IS6110 probe,† 5 μL DNA template. Total volume 25 μL | 95°C for 5 min; 45 cycles: 95°C for 10 s/denaturation; 50°C for 30 s/annealing; 72°C for 1 s/extension. Termination at 65°C–95°C at 2.2°C/s/melting curve analysis |
*QIAGEN, Inc., Valencia, CA, USA.
†Roche, Indianapolis, IN, USA
Page created: February 18, 2015
Page updated: February 18, 2015
Page reviewed: February 18, 2015
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.