Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 22, Number 2—February 2016
Research

Trematode Fluke Procerovum varium as Cause of Ocular Inflammation in Children, South India

Lalan Kumar Arya, Sivakumar R. Rathinam, Prajna Lalitha, Usha R. Kim, Sudeep Ghatani, and Veena Tandon1Comments to Author 
Author affiliations: Aravind Medical Research Foundation, Madurai, India (L.K. Arya, P. Lalitha); Aravind Eye Hospital and Postgraduate Institute of Ophthalmology, Madurai (S.R. Rathinam, U.R. Kim); North-Eastern Hill University, Shillong, India (S. Ghatani, V. Tandon)

Main Article

Table 1

Primers used for amplification of the DNA region ITS2 and the 28S rDNA of trematode found as the source of ocular granulomas in children, South India*

DNA partition Primer name Primer sequence, 5′→ 3′ DNA amplicon size, bp Application Reference
ITS2 3SF GGTACCGGTGGATCACTCGGCTCGTG 539 PCR and sequencing (29)
BD2R GGGATCCTGGTTAGTTTCTTTTCCTCCGC
ITS2 AP101F ATGAATGGCGCAGCTTTGACATCG 156 Real-time PCR This study
AP101R AAAGCACAAGGAAATCACGCCAGC
ITS2 AP102 F AGAGCGCAGCCAACTGTGTGA 369 Real-time PCR and sequencing This study
AP102 R TGCCACGTCCTAGCATCAGCC
28S rDNA AP103 F AGAGCGCAGCCAACTGTGTGA 715 PCR and sequencing This study
AP103 R TGCCACGTCCTAGCATCAGCC

*ITS, internal transcribed spacer.

Main Article

References
  1. Sabrosa  NA, Cunningham  ET Jr, Arevalo  JF. Ocular nematode and trematode infections in the developing world. Int Ophthalmol Clin. 2010;50:71–85. DOIPubMedGoogle Scholar
  2. Nimir  AR, Saliem  A, Ibrahim  IA. Ophthalmic parasitosis: a review article. Interdiscip Perspect Infect Dis. 2012;2012:587402. Epub 2012 Sep 16.PMID: 23024652DOIGoogle Scholar
  3. Johansen  MV, Sithithaworn  P, Bergquist  R, Utzinger  J. Towards improved diagnosis of zoonotic trematode infections in Southeast Asia. Adv Parasitol. 2010;73:171–95. DOIPubMedGoogle Scholar
  4. Srivatanakul  P, Viyanant  V, Kurathong  S, Tiwawech  D. Enzyme-linked immunosorbent assay for detection of Opisthorchis viverrini infection. Southeast Asian J Trop Med Public Health. 1985;16:234–9.PubMedGoogle Scholar
  5. Gómez-Morales  MA, Ludovisi  A, Amati  M, Pozio  E. Validation of an excretory/secretory antigen based-Elisa for the diagnosis of Opisthorchis felineus infection in humans from low trematode endemic areas. PLoS ONE. 2013;8:e62267. DOIPubMedGoogle Scholar
  6. Lovis  L, Mak  TK, Phongluxa  K, Soukhathammavong  P, Sayasone  S, Akkhavong  K, PCR diagnosis of Opisthorchis viverrini and Haplorchistaichui infections in an endemic Lao community: a comparison of diagnostic methods for parasitological field surveys. J Clin Microbiol. 2009;47:1517–23. DOIPubMedGoogle Scholar
  7. De  NV, Le  TH. Human infections of fish-borne trematodes in Vietnam: prevalence and molecular specific identification at an endemic commune in Nam Dinh province. Exp Parasitol. 2011;129:355–61. DOIPubMedGoogle Scholar
  8. Hoti  SL, Tandon  V. Ocular parasitoses and their immunology. Ocul Immunol Inflamm. 2011;19:385–96. DOIPubMedGoogle Scholar
  9. Dissanaike  AS, Bilimoria  DP. On an infection of a human eye with Philopthalmus sp. in Ceylon. J Helminthol. 1958;32:115–8. DOIPubMedGoogle Scholar
  10. Alicata  JE, Ching  HL. On the infection of birds and mammals with the cercaria and metacercaria of the eye-fluke, Philophthalmus. J Parasitol. 1960;46:16.
  11. Mimori  T, Hirai  H, Kifune  T, Inada  L. Philopthalmus sp. (Trematoda) in a human eye. Am J Trop Med Hyg. 1982;31:859–61.PubMedGoogle Scholar
  12. Gutierrez  Y, Grossniklaus  HE, Annable  WL. Human conjunctivitis caused by the bird parasite Philopthalmus. Am J Ophthalmol. 1987;104:417–9. DOIPubMedGoogle Scholar
  13. Lang  Y, Weiss  Y, Garzozi  H, Gold  D, Lengy  J. A first instance of human philophthalmosis in Israel. J Helminthol. 1993;67:107–11. DOIPubMedGoogle Scholar
  14. Waikagul  J, Dekumyoy  P, Yoonuan  T, Praevanit  R. Conjunctiva philophthalmosis: a case report in Thailand. Am J Trop Med Hyg. 2006;74:848–9.PubMedGoogle Scholar
  15. Dalimi  A, Jabarvandb  M. Fasciola hepatica in the human eye. Trans R Soc Trop Med Hyg. 2005;99:798–800. DOIPubMedGoogle Scholar
  16. Cairo  MI. Schistosomal granulomatosis of the conjunctiva. Eye Ear Nose Throat Mon. 1967;46:452–4.PubMedGoogle Scholar
  17. Rathinam  S, Fritsche  TR, Srinivasan  M, Vijayalakshmi  P, Read  RW, Gautom  R, An outbreak of trematode-induced granulomas of the conjunctiva. Ophthalmology. 2001;108:1223–9. DOIPubMedGoogle Scholar
  18. Rathinam  SR, Usha  KR, Rao  NA. Presumed trematode induced granulomatous anterior uveitis: a newly recognized cause of intraocular inflammation in children from South India. Am J Ophthalmol. 2002;133:773–9. DOIPubMedGoogle Scholar
  19. Rathinam  SR, Arya  LK, Usha  KR, Prajna  L, Tandon  V. Novel etiological agent: molecular evidence for trematode-induced anterior uveitis in children. Arch Ophthalmol. 2012;130:1481–4. DOIPubMedGoogle Scholar
  20. Ooi  HK, Chen  CI, Lln  SC, Tung  KC, Wang  JS, Kamiya  M. Metacercariae in fishes of Sun Moon lake, which is an endemic area for Clonorchissinensis in Taiwan. Southeast Asian J Trop Med Public Health. 1997;28(Suppl 1):222–3.PubMedGoogle Scholar
  21. Umadevi  K, Madhavi  R. Observations on the morphology and life-cycle of Procerovumvarium (Onji & Nishio, 1916) (Trematoda: Heterophyidae). Syst Parasitol. 2000;46:215–25. DOIPubMedGoogle Scholar
  22. Ooi  HK, Wang  WS, Tu  CY, Chang  HY, Chen  CI. Natural mass infection by heterophyid metacercariae in aquacultured Japanese eel in Taiwan. Dis Aquat Organ. 1999;35:31–6. DOIPubMedGoogle Scholar
  23. Phan  VT, Ersbøll  AK, Nguyen  KV, Madsen  H, Dalsgaard  A. Farm-level risk factors for fish-borne zoonotic trematode infection in integrated small-scale fish farms in Northern Vietnam. PloS Negl Trop Dis. 2010;4:e742. DOIPubMedGoogle Scholar
  24. Wiriya  B, Clausen  JH, Inpankaew  T, Thaenkham  U, Jittapalapong  S, Satapornvanit  K, Fish-borne trematodes in cultured Nile tilapia (Oreochromisniloticus) and wild-caught fish from Thailand. Vet Parasitol. 2013;198:230–4. DOIPubMedGoogle Scholar
  25. Jefferies  R, Morgan  ER, Shaw  SE. A SYBR green real-time PCR assay for the detection of the nematode Angiostrongylus vasorum in definitive and intermediate hosts. Vet Parasitol. 2009;166:112–8. DOIPubMedGoogle Scholar
  26. Gomes  AL, Melo  FL, Werkhauser  RP, Abath  FG. Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA. Mem Inst Oswaldo Cruz. 2006;101(Suppl 1):133–6. DOIPubMedGoogle Scholar
  27. Matsuu  A, Ono  S, Ikadai  H, Uchide  T, Imamura  S, Onuma  M, Development of a SYBR green real-time polymerase chain reaction assay for quantitative detection of Babesia gibsoni (Asian genotype) DNA. J Vet Diagn Invest. 2005;17:569–73. DOIPubMedGoogle Scholar
  28. Hung  YW, Remais  J. Quantitative detection of Schistosoma japonicum cercariae in water by real-time PCR. PloS Negl Trop Dis. 2008;2:e337. DOIPubMedGoogle Scholar
  29. Bowles  J, Blair  D, McManus  DP. A molecular phylogeny of the human schistosomes. Mol Phylogenet Evol. 1995;4:103–9. DOIPubMedGoogle Scholar
  30. Phan  VT, Ersbøll  AK, Nguyen  KV, Madsen  H, Dalsgaard  A. Farm-level risk factors for fish- borne zoonotic trematode infection in integrated small-scale fish farms in northern Vietnam. PloS Negl Trop Dis. 2010;4:e742. DOIPubMedGoogle Scholar
  31. Dung  BT, Madsen  H. Distribution of freshwater snails in family-based VAC ponds and associated waterbodies with special reference to intermediate hosts of fish-borne zoonotic trematodes in Nam Dinh Province, Vietnam. Acta Trop. 2010;116:15–23. DOIPubMedGoogle Scholar
  32. Jayawardena  UA, Rajakaruna  RS, Amerasinghe  PH. Cercariae of trematodes in freshwater snails in three climatic zones in Sri Lanka. Cey J Sci. 2010;39:95–108.
  33. Chontananarth  T, Wongsawad  C. Epidemiology of cercarial stage of trematodes in freshwater snails from Chiang Mai province, Thailand. Asian Pac J Trop Biomed. 2013;3:237–43. DOIPubMedGoogle Scholar
  34. White  BA, editor. PCR protocols: current methods and applications (methods in molecular biology: 15). Totowa (NJ): Humana Press; 1993.
  35. Tandon  V, Prasad  PK, Chatterjee  A, Bhutia  PT. Surface fine topography and PCR-based determination of Paragonimus sp. metacercaria from edible crabs in Arunachal Pradesh, Northeast India. Parasitol Res. 2007;102:21–8. DOIPubMedGoogle Scholar
  36. Prasad  PK, Tandon  V, Chatterjee  A, Bandyopadhyay  S. PCR based determination of internal transcribed spacer (ITS) regions of ribosomal DNA of giant intestinal fluke, Fasciolopsis buski (Lankester, 1857) Looss, 1899. Parasitol Res. 2007;101:1581–7. DOIPubMedGoogle Scholar
  37. Rajamohan  M, Srikanth  K, Raghuraman  V, Srinivasan  R, Nelson Jesudasan  CA. Conglomerate tubercle—myth or reality? Tamil Nadu Ophthalmic Assoc J. 1998;38:23–4.
  38. Mendes  MO, Moraes  MA, Renoiner  EI, Dantas  MH, Lanzieri  TM, Fonseca  CF, Acute conjunctivitis with episcleritis and anterior uveitis linked to adiaspiromycosis and freshwater sponges, Amazon region, Brazil, 2005. Emerg Infect Dis. 2009;15:633–9. DOIPubMedGoogle Scholar
  39. Hotez  PJ. The neglected tropical diseases and the neglected infections of poverty: overview of their common features, global disease burden and distribution, new control tools, and prospects for disease elimination. In: Institute of Medicine (US) Forum on Microbial Threats. The causes and impacts of neglected tropical and zoonotic diseases: opportunities for integrated intervention strategies. Washington (DC): National Academies Press; 2011. A7.

Main Article

1Current affiliation: National Academy of Sciences, India, Lucknow, India.

Page created: January 13, 2016
Page updated: January 13, 2016
Page reviewed: January 13, 2016
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external