Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 22, Number 5—May 2016

Research

Expanded Geographic Distribution and Clinical Characteristics of Ehrlichia ewingii Infections, United States

Rebecca M. Harris1, Brianne A. Couturier, Stephan C. Sample, Katrina S. Coulter, Kathleen K. Casey, and Robert SchlabergComments to Author 
Author affiliations: Author affiliations: University of Utah School of Medicine, Salt Lake City, Utah, USA (R.M. Harris, R. Schlaberg); Associated Regional and University Pathologists Institute for Clinical and Experimental Pathology, Salt Lake City (B.A. Couturier, R. Schlaberg); Memorial Hospital and Healthcare Center, Jasper, Indiana, USA (S.C. Sample); University of Arkansas for Medical Sciences, Little Rock, Arkansas, USA (K.S. Coulter); Jersey Shore University Medical Center, Neptune, New Jersey, USA (K.K. Casey)

Main Article

Table 1

Primers and probes used in real-time PCR for Ehrlichia and Anaplasma species, United States*

Name Sequence, 5′ → 3′ Concentration, nmol/L Species detected
Primer 1 GCATTACTCACCCGTCTGCCACT 250 –
Primer 2 CAAGCCTAACACATGCAAGTCGAACG 1,000 –
Probe 1 MGB-FAM-AGGT†T†ATAA†GCA†ATTGTCC-EDQ 200 E. chaffenisis
Probe 2 MGB-(AP642)-AAGCTATA†GGCA†GT†TA†TCC-EDQ 200 E. muris–like agent
Probe 3 MGB-(AP593)-GGCTATA†A†ATA†A†TTGT†CCG-EDQ 200 E. canis
Probe 4 MGB-(AP593)-CTATTTA†GGA†A†TTGT†T†C-EDQ 200 E. ewingii
Probe 5 MGB-(AP525)-AAAGAAT†A†A†TCCGTTCG-EDQ 200 A. phagocytophilum

*–, these primers are specific for 5 organisms; MGB, minor groove binder; FAM, 6-carboxyfluorescein; EDQ, Eclipse Dark Quencher (Epoch Biosciences Inc., Bothell, WA, USA).
†Use of Super A, T, or G (Epoch Biosciences Inc.).

Main Article

1Current affiliation: Icahn School of Medicine at Mount Sinai, New York, NY, USA.

Page created: April 13, 2016
Page updated: April 13, 2016
Page reviewed: April 13, 2016
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external