Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 23, Number 11—November 2017

Dispatch

Lineage-Specific Real-Time RT-PCR for Yellow Fever Virus Outbreak Surveillance, Brazil

Carlo Fischer1, Maria C. Torres1, Pranav Patel, Andres Moreira-Soto, Ernest A. Gould, Rémi N. Charrel, Xavier de Lamballerie, Rita Maria Ribeiro Nogueira, Patricia C. Sequeira, Cintia D.S. Rodrigues, Beate M. Kümmerer, Christian Drosten, Olfert Landt, Ana Maria Bispo de FilippisComments to Author , and Jan Felix DrexlerComments to Author 
Author affiliations: University of Bonn Medical Centre, Bonn, Germany (C. Fischer, A. Moreira-Soto, B.M. Kümmerer); German Centre for Infection Research (DZIF) (C. Fischer, C. Drosten, J.F. Drexler); Instituto Oswaldo Cruz, Rio de Janeiro, Brazil (M.C. Torres, R.M.R. Nogueira, P.C. Sequeira, C.D.S. Rodrigues, A.M.B. de Filippis); TIB MOLBIOL Syntheselabor GmbH, Berlin, Germany (P. Patel, O. Landt); Charité–Universitätsmedizin Berlin, corporate member of Freie Universität Berlin, Humboldt-Universität zu Berlin, and Berlin Institute of Health, Institute of Virology, Germany (A. Moreira-Soto, C. Drosten, J.F. Drexler); Aix-Marseille University, Marseille, France (E.A. Gould, R.N. Charrel, X. de Lamballerie); Institut Hospitalo Universitaire Méditerranée-Infection, Marseille (R.N. Charrel, X. de Lamballerie)

Main Article

Table

Oligonucleotides for new yellow fever virus real-time RT-PCRs*

Oligonucleotide name
Primer/probe†
Sequence, 5′ → 3′‡
Target genomic domain, no. bases
Orientation
Single-target assay
YFVsingle-fwd Primer GTGGAGRAGCAGRGCRGATGAG 2,653–2,674 +
YFVsingle-rv Primer AAHGGRTGWGTYCCTCTCTGR 2,743–2,763 -
YFVsingleP-vac Probe (FAM) TTCTGTTGTCGTGCAGGATCCAAAGAATG 2,710–2,738 +
YFVsingleP-wt
Probe (YAK)
TAGAYATYTCAGTGGTGGTYCAAGACYC
2,703–2,730
+
Dual-target assay
YFVdual-fwd-vac Primer GGGACTAGCGTGATCATTGA 3,296–3,315 +
YFVdual-rv-vac Primer GAATAACTTTCCCGCTATCCGT 3,356–3,377 -
YFVdualP-vac Probe (FAM) TCCCCGTCCATCACAGTTGCC 3,317–3,337 -
YFVdual-fwd-wt Primer CAATGCCATYCTTGAGGAGAAT 2,677–2,698 +
YFVdual-rv-wt Primer CGGATGTGTCCCTCTCTG 2,744–2,761 -
YFVdualP-wt Probe (YAK) TCTTGRACCACCACTGAGATGTCTACC 2,701–2,727 -

*25 µL real-time RT-PCR reactions were performed using the Superscript III one-step RT-PCR system with Platinum Taq polymerase (Thermo Fisher Scientific, Darmstadt, Germany). Target genomic domain positions according to GenBank reference genome NC_002031. Reactions were set up with 5 μL of RNA; 12.5 μL of 2× reaction buffer; 0.4 μL of a 50 mM magnesium sulfate solution (Superscript III one-step RT–PCR system with Platinum Taq polymerase kit, Thermo Fisher Scientific); 1 μg of nonacetylated bovine serum albumin; and 1 µL enzyme. Single-target assay reactions contained 400 nM forward primer, 600 nM reverse primer, and 280 nM of each probe. Dual-target assay reactions contained 400 nM of each primer and 220 nM of each probe. RT-PCR, reverse transcription PCR.
†Probes are labeled with either fluorescein amidite (FAM) or Yakima Yellow (YAK) at the 5′-end and a Black Hole Quencher (TIB MOLBIOL Syntheselabor GmbH, Berlin, Germany) at the 3′-end. Primer concentrations were optimized using the YFV vaccine strain IVT and the wild-type YFV IVT. Amplification involved 50°C for 15 min, followed by 95°C for 3 min and 45 cycles of 95°C for 15 s and 58°C for 30 s with fluorescence read at the 58° annealing/extension step on a LightCycler 480 thermocycler (Roche, Basel, Switzerland).
‡H = A/C/T, M = A/C, R = A/G, W = A/T, Y = C/T.

Main Article

1These authors contributed equally to this article.

TOP