Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 23, Number 11—November 2017

Dispatch

Lineage-Specific Real-Time RT-PCR for Yellow Fever Virus Outbreak Surveillance, Brazil

Carlo Fischer1, Maria C. Torres1, Pranav Patel, Andres Moreira-Soto, Ernest A. Gould, Rémi N. Charrel, Xavier de Lamballerie, Rita Maria Ribeiro Nogueira, Patricia C Sequeira, Cintia D S Rodrigues, Beate M. Kümmerer, Christian Drosten, Olfert Landt, Ana Maria Bispo de FilippisComments to Author , and Jan Felix DrexlerComments to Author 
Author affiliations: University of Bonn Medical Centre, Bonn, Germany (C. Fischer, A. Moreira-Soto, B.M. Kümmerer); German Centre for Infection Research (DZIF) (C. Fischer, C. Drosten, J.F. Drexler); Instituto Oswaldo Cruz, Rio de Janeiro, Brazil (M.C. Torres, R.M.R. Nogueira, P.C. Sequeira, C.D.S. Rodrigues, A.M.B. de Filippis); TIB MOLBIOL Syntheselabor GmbH, Berlin, Germany (P. Patel, O. Landt); Charité–Universitätsmedizin Berlin, corporate member of Freie Universität Berlin, Humboldt-Universität zu Berlin, and Berlin Institute of Health, Institute of Virology, Germany (A. Moreira-Soto, C. Drosten, J.F. Drexler); Aix-Marseille University, Marseille, France (E.A. Gould, R.N. Charrel, X. de Lamballerie); Institut Hospitalo Universitaire Méditerranée-Infection, Marseille (R.N. Charrel, X. de Lamballerie)

Main Article

Table

Oligonucleotides for new yellow fever virus real-time RT-PCRs*

Oligonucleotide name
Primer/probe†
Sequence, 5′ → 3′‡
Target genomic domain, no. bases
Orientation
Single-target assay
YFVsingle-fwd Primer GTGGAGRAGCAGRGCRGATGAG 2,653–2,674 +
YFVsingle-rv Primer AAHGGRTGWGTYCCTCTCTGR 2,743–2,763 -
YFVsingleP-vac Probe (FAM) TTCTGTTGTCGTGCAGGATCCAAAGAATG 2,710–2,738 +
YFVsingleP-wt
Probe (YAK)
TAGAYATYTCAGTGGTGGTYCAAGACYC
2,703–2,730
+
Dual-target assay
YFVdual-fwd-vac Primer GGGACTAGCGTGATCATTGA 3,296–3,315 +
YFVdual-rv-vac Primer GAATAACTTTCCCGCTATCCGT 3,356–3,377 -
YFVdualP-vac Probe (FAM) TCCCCGTCCATCACAGTTGCC 3,317–3,337 -
YFVdual-fwd-wt Primer CAATGCCATYCTTGAGGAGAAT 2,677–2,698 +
YFVdual-rv-wt Primer CGGATGTGTCCCTCTCTG 2,744–2,761 -
YFVdualP-wt Probe (YAK) TCTTGRACCACCACTGAGATGTCTACC 2,701–2,727 -

*25 µL real-time RT-PCR reactions were performed using the Superscript III one-step RT-PCR system with Platinum Taq polymerase (Thermo Fisher Scientific, Darmstadt, Germany). Target genomic domain positions according to GenBank reference genome NC_002031. Reactions were set up with 5 μL of RNA; 12.5 μL of 2× reaction buffer; 0.4 μL of a 50 mM magnesium sulfate solution (Superscript III one-step RT–PCR system with Platinum Taq polymerase kit, Thermo Fisher Scientific); 1 μg of nonacetylated bovine serum albumin; and 1 µL enzyme. Single-target assay reactions contained 400 nM forward primer, 600 nM reverse primer, and 280 nM of each probe. Dual-target assay reactions contained 400 nM of each primer and 220 nM of each probe. RT-PCR, reverse transcription PCR.
†Probes are labeled with either fluorescein amidite (FAM) or Yakima Yellow (YAK) at the 5′-end and a Black Hole Quencher (TIB MOLBIOL Syntheselabor GmbH, Berlin, Germany) at the 3′-end. Primer concentrations were optimized using the YFV vaccine strain IVT and the wild-type YFV IVT. Amplification involved 50°C for 15 min, followed by 95°C for 3 min and 45 cycles of 95°C for 15 s and 58°C for 30 s with fluorescence read at the 58° annealing/extension step on a LightCycler 480 thermocycler (Roche, Basel, Switzerland).
‡H = A/C/T, M = A/C, R = A/G, W = A/T, Y = C/T.

Main Article

1These authors contributed equally to this article.

TOP