Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 24, Number 11—November 2018
Research

Detection of Tickborne Relapsing Fever Spirochete, Austin, Texas, USA

Jack D. Bissett, Suzanne Ledet, Aparna Krishnavajhala, Brittany A. Armstrong, Anna Klioueva, Christopher Sexton, Adam Replogle, Martin E. Schriefer, and Job E. LopezComments to Author 
Author affiliations: Seton Medical Center, Austin Texas, USA (J.D. Bissett, S. Ledet); Baylor College of Medicine, Houston, Texas, USA (A. Krishnavajhala, B.A. Armstrong, J.E. Lopez); Austin Public Health, Austin (A. Klioueva); Centers for Disease Control and Prevention, Fort Collins, Colorado, USA (C. Sexton, A. Replogle, M.E. Schriefer)

Main Article

Table

PCR primers used in multilocus sequence analysis of tickborne relapsing fever spirochete, Austin, Texas, USA*

Gene locus and primer
 Primer sequence, 5′ → 3′
rrs
UniB† TACAAGGAGGTGATCCAGC
FD3† AGAGTTTGATCCTGGCTTAG
16s (–)‡ TAGAAGTTCGCCTTCGCCTCTG
16s (+)‡ TACAGGTGCTGCATGGTTGTCG
Rec 4‡ ATGCTAGAAACTGCATGA
P6 Rev TTTACAGCGTAGACTACCAG
P8 For AAACGATGCACACTTGGTGT
P10 Rev
 ACATAAGGGCCATGATGATT
flaB
flaLL§ ACATATTCAGATGCAGACAGAGGT
flaRL§
 GCAATCATAGCCATTGCAGATTGT
gyrB
gyrB 5′+3§ GCTGATGCTGATGTTGATGG
gyrB 3′§ GGCTCTTGAAACAATAACAGACATCGC

*flaB, flagellin B; For, forward; gyrB, gyrase B; Rev, reverse; rrs, 16S rRNA.
†Reported by Le Fleche et al. (19).
‡Reported by Porcella et al. (20).
§Reported by Barbour et al. (21).

Main Article

References
  1. Dworkin  MS, Schwan  TG, Anderson  DE Jr, Borchardt  SM. Tick-borne relapsing fever. [viii.]. Infect Dis Clin North Am. 2008;22:449–68, viii. DOIPubMedGoogle Scholar
  2. Rawlings  JA. An overview of tick-borne relapsing fever with emphasis on outbreaks in Texas. Tex Med. 1995;91:56–9.PubMedGoogle Scholar
  3. Christensen  AM, Pietralczyk  E, Lopez  JE, Brooks  C, Schriefer  ME, Wozniak  E, et al. Diagnosis and management of Borrelia turicatae infection in febrile soldier, Texas, USA. Emerg Infect Dis. 2017;23:883–4. DOIPubMedGoogle Scholar
  4. Davis  GE. Relapsing fever: the tick Ornithodoros turicata as a spirochetal reservoir. Public Health Rep. 1943;58:839–42. DOIGoogle Scholar
  5. Boyle  WK, Wilder  HK, Lawrence  AM, Lopez  JE. Transmission dynamics of Borrelia turicatae from the arthropod vector. PLoS Negl Trop Dis. 2014;8:e2767. DOIPubMedGoogle Scholar
  6. Davis  GE. Ornithodoros turicata:the male; feeding and copulation habits, fertility, span of life, and the transmission of relapsing fever spirochetes. Public Health Rep. 1941;56:1799–802. DOIGoogle Scholar
  7. Donaldson  TG, Pèrez de León  AA, Li  AY, Castro-Arellano  I, Wozniak  E, Boyle  WK, et al. Assessment of the geographic distribution of Ornithodoros turicata (Argasidae): climate variation and host diversity. PLoS Negl Trop Dis. 2016;10:e0004383. DOIPubMedGoogle Scholar
  8. Adeyeye  OA, Butler  JF. Field evaluation of carbon dioxide baits for sampling Ornithodoros turicata (Acari: Argasidae) in gopher tortoise burrows. J Med Entomol. 1991;28:45–8. DOIPubMedGoogle Scholar
  9. Schwan  TG, Raffel  SJ, Schrumpf  ME, Policastro  PF, Rawlings  JA, Lane  RS, et al. Phylogenetic analysis of the spirochetes Borrelia parkeri and Borrelia turicatae and the potential for tick-borne relapsing fever in Florida. J Clin Microbiol. 2005;43:3851–9. DOIPubMedGoogle Scholar
  10. Piccione  J, Levine  GJ, Duff  CA, Kuhlman  GM, Scott  KD, Esteve-Gassent  MD. Tick-borne relapsing fever in dogs. J Vet Intern Med. 2016;30:1222–8. DOIPubMedGoogle Scholar
  11. Kingry  LC, Batra  D, Replogle  A, Sexton  C, Rowe  L, Stermole  BM, et al. Chromosome and linear plasmid sequences of a 2015 human isolate of the tick-borne relapsing fever spirochete, Borrelia turicatae. Genome Announc. 2016;4:4. DOIPubMedGoogle Scholar
  12. Lopez  JE, Schrumpf  ME, Nagarajan  V, Raffel  SJ, McCoy  BN, Schwan  TG. A novel surface antigen of relapsing fever spirochetes can discriminate between relapsing fever and Lyme borreliosis. Clin Vaccine Immunol. 2010;17:564–71. DOIPubMedGoogle Scholar
  13. Lopez  JE, Wilder  HK, Boyle  W, Drumheller  LB, Thornton  JA, Willeford  B, et al. Sequence analysis and serological responses against Borrelia turicatae BipA, a putative species-specific antigen. PLoS Negl Trop Dis. 2013;7:e2454. DOIPubMedGoogle Scholar
  14. Breuner  NE, Dolan  MC, Replogle  AJ, Sexton  C, Hojgaard  A, Boegler  KA, et al. Transmission of Borrelia miyamotoi sensu lato relapsing fever group spirochetes in relation to duration of attachment by Ixodes scapularis nymphs. Ticks Tick Borne Dis. 2017;8:677–81. DOIPubMedGoogle Scholar
  15. Wilder  HK, Wozniak  E, Huddleston  E, Tata  SR, Fitzkee  NC, Lopez  JE. Case report: A retrospective serological analysis indicating human exposure to tick-borne relapsing fever spirochetes in Texas. PLoS Negl Trop Dis. 2015;9:e0003617. DOIPubMedGoogle Scholar
  16. Krajacich  BJ, Lopez  JE, Raffel  SJ, Schwan  TG. Vaccination with the variable tick protein of the relapsing fever spirochete Borrelia hermsii protects mice from infection by tick-bite. Parasit Vectors. 2015;8:546. DOIPubMedGoogle Scholar
  17. Battisti  JM, Raffel  SJ, Schwan  TG. A system for site-specific genetic manipulation of the relapsing fever spirochete Borrelia hermsii. Methods Mol Biol. 2008;431:69–84.PubMedGoogle Scholar
  18. Simpson  WJ, Garon  CF, Schwan  TG. Analysis of supercoiled circular plasmids in infectious and non-infectious Borrelia burgdorferi. Microb Pathog. 1990;8:109–18. DOIPubMedGoogle Scholar
  19. Le Fleche  A, Postic  D, Girardet  K, Peter  O, Baranton  G. Characterization of Borrelia lusitaniae sp. nov. by 16S ribosomal DNA sequence analysis. Int J Syst Bacteriol. 1997;47:921–5. DOIPubMedGoogle Scholar
  20. Porcella  SF, Raffel  SJ, Anderson  DE Jr, Gilk  SD, Bono  JL, Schrumpf  ME, et al. Variable tick protein in two genomic groups of the relapsing fever spirochete Borrelia hermsii in western North America. Infect Immun. 2005;73:6647–58. DOIPubMedGoogle Scholar
  21. Barbour  AG, Maupin  GO, Teltow  GJ, Carter  CJ, Piesman  J. Identification of an uncultivable Borrelia species in the hard tick Amblyomma americanum: possible agent of a Lyme disease-like illness. J Infect Dis. 1996;173:403–9. DOIPubMedGoogle Scholar
  22. Eads  RB, Henderson  HE, McGregor  T, Irons  JV. Relapsing fever in Texas; distribution of laboratory confirmed cases and the arthropod reservoirs. Am J Trop Med Hyg. 1950;30:73–6. DOIPubMedGoogle Scholar
  23. Brumpt  E. Study of Spirochaeta turicatae, n. sp., agent of sporadic recurrent fever of the United States transmitted by Ornithodoros turicata [in French]. Comptes Rendus des Séances de la Société de Biologie et de ses Filiales (Paris). 1933;13:1369.
  24. Whitney  MS, Schwan  TG, Sultemeier  KB, McDonald  PS, Brillhart  MN. Spirochetemia caused by Borrelia turicatae infection in 3 dogs in Texas. Vet Clin Pathol. 2007;36:212–6. DOIPubMedGoogle Scholar
  25. Francis  E. Longevity of the tick Ornithodoros turicata and of Spirochaeta recurrentis with this tick. Public Health Rep. 1938;53:2220–41. DOIGoogle Scholar
  26. Dworkin  MS, Shoemaker  PC, Fritz  CL, Dowell  ME, Anderson  DE Jr. The epidemiology of tick-borne relapsing fever in the United States. Am J Trop Med Hyg. 2002;66:753–8. DOIPubMedGoogle Scholar

Main Article

Page created: October 16, 2018
Page updated: October 16, 2018
Page reviewed: October 16, 2018
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external