Volume 24, Number 11—November 2018
Research
Detection of Tickborne Relapsing Fever Spirochete, Austin, Texas, USA
Table
PCR primers used in multilocus sequence analysis of tickborne relapsing fever spirochete, Austin, Texas, USA*
Gene locus and primer |
Primer sequence, 5′ → 3′ |
---|---|
rrs | |
UniB† | TACAAGGAGGTGATCCAGC |
FD3† | AGAGTTTGATCCTGGCTTAG |
16s (–)‡ | TAGAAGTTCGCCTTCGCCTCTG |
16s (+)‡ | TACAGGTGCTGCATGGTTGTCG |
Rec 4‡ | ATGCTAGAAACTGCATGA |
P6 Rev | TTTACAGCGTAGACTACCAG |
P8 For | AAACGATGCACACTTGGTGT |
P10 Rev |
ACATAAGGGCCATGATGATT |
flaB | |
flaLL§ | ACATATTCAGATGCAGACAGAGGT |
flaRL§ |
GCAATCATAGCCATTGCAGATTGT |
gyrB | |
gyrB 5′+3§ | GCTGATGCTGATGTTGATGG |
gyrB 3′§ | GGCTCTTGAAACAATAACAGACATCGC |
References
- Dworkin MS, Schwan TG, Anderson DE Jr, Borchardt SM. Tick-borne relapsing fever. [viii.]. Infect Dis Clin North Am. 2008;22:449–68, viii. DOIPubMedGoogle Scholar
- Rawlings JA. An overview of tick-borne relapsing fever with emphasis on outbreaks in Texas. Tex Med. 1995;91:56–9.PubMedGoogle Scholar
- Christensen AM, Pietralczyk E, Lopez JE, Brooks C, Schriefer ME, Wozniak E, et al. Diagnosis and management of Borrelia turicatae infection in febrile soldier, Texas, USA. Emerg Infect Dis. 2017;23:883–4. DOIPubMedGoogle Scholar
- Davis GE. Relapsing fever: the tick Ornithodoros turicata as a spirochetal reservoir. Public Health Rep. 1943;58:839–42. DOIGoogle Scholar
- Boyle WK, Wilder HK, Lawrence AM, Lopez JE. Transmission dynamics of Borrelia turicatae from the arthropod vector. PLoS Negl Trop Dis. 2014;8:e2767. DOIPubMedGoogle Scholar
- Davis GE. Ornithodoros turicata:the male; feeding and copulation habits, fertility, span of life, and the transmission of relapsing fever spirochetes. Public Health Rep. 1941;56:1799–802. DOIGoogle Scholar
- Donaldson TG, Pèrez de León AA, Li AY, Castro-Arellano I, Wozniak E, Boyle WK, et al. Assessment of the geographic distribution of Ornithodoros turicata (Argasidae): climate variation and host diversity. PLoS Negl Trop Dis. 2016;10:e0004383. DOIPubMedGoogle Scholar
- Adeyeye OA, Butler JF. Field evaluation of carbon dioxide baits for sampling Ornithodoros turicata (Acari: Argasidae) in gopher tortoise burrows. J Med Entomol. 1991;28:45–8. DOIPubMedGoogle Scholar
- Schwan TG, Raffel SJ, Schrumpf ME, Policastro PF, Rawlings JA, Lane RS, et al. Phylogenetic analysis of the spirochetes Borrelia parkeri and Borrelia turicatae and the potential for tick-borne relapsing fever in Florida. J Clin Microbiol. 2005;43:3851–9. DOIPubMedGoogle Scholar
- Piccione J, Levine GJ, Duff CA, Kuhlman GM, Scott KD, Esteve-Gassent MD. Tick-borne relapsing fever in dogs. J Vet Intern Med. 2016;30:1222–8. DOIPubMedGoogle Scholar
- Kingry LC, Batra D, Replogle A, Sexton C, Rowe L, Stermole BM, et al. Chromosome and linear plasmid sequences of a 2015 human isolate of the tick-borne relapsing fever spirochete, Borrelia turicatae. Genome Announc. 2016;4:4. DOIPubMedGoogle Scholar
- Lopez JE, Schrumpf ME, Nagarajan V, Raffel SJ, McCoy BN, Schwan TG. A novel surface antigen of relapsing fever spirochetes can discriminate between relapsing fever and Lyme borreliosis. Clin Vaccine Immunol. 2010;17:564–71. DOIPubMedGoogle Scholar
- Lopez JE, Wilder HK, Boyle W, Drumheller LB, Thornton JA, Willeford B, et al. Sequence analysis and serological responses against Borrelia turicatae BipA, a putative species-specific antigen. PLoS Negl Trop Dis. 2013;7:e2454. DOIPubMedGoogle Scholar
- Breuner NE, Dolan MC, Replogle AJ, Sexton C, Hojgaard A, Boegler KA, et al. Transmission of Borrelia miyamotoi sensu lato relapsing fever group spirochetes in relation to duration of attachment by Ixodes scapularis nymphs. Ticks Tick Borne Dis. 2017;8:677–81. DOIPubMedGoogle Scholar
- Wilder HK, Wozniak E, Huddleston E, Tata SR, Fitzkee NC, Lopez JE. Case report: A retrospective serological analysis indicating human exposure to tick-borne relapsing fever spirochetes in Texas. PLoS Negl Trop Dis. 2015;9:e0003617. DOIPubMedGoogle Scholar
- Krajacich BJ, Lopez JE, Raffel SJ, Schwan TG. Vaccination with the variable tick protein of the relapsing fever spirochete Borrelia hermsii protects mice from infection by tick-bite. Parasit Vectors. 2015;8:546. DOIPubMedGoogle Scholar
- Battisti JM, Raffel SJ, Schwan TG. A system for site-specific genetic manipulation of the relapsing fever spirochete Borrelia hermsii. Methods Mol Biol. 2008;431:69–84.PubMedGoogle Scholar
- Simpson WJ, Garon CF, Schwan TG. Analysis of supercoiled circular plasmids in infectious and non-infectious Borrelia burgdorferi. Microb Pathog. 1990;8:109–18. DOIPubMedGoogle Scholar
- Le Fleche A, Postic D, Girardet K, Peter O, Baranton G. Characterization of Borrelia lusitaniae sp. nov. by 16S ribosomal DNA sequence analysis. Int J Syst Bacteriol. 1997;47:921–5. DOIPubMedGoogle Scholar
- Porcella SF, Raffel SJ, Anderson DE Jr, Gilk SD, Bono JL, Schrumpf ME, et al. Variable tick protein in two genomic groups of the relapsing fever spirochete Borrelia hermsii in western North America. Infect Immun. 2005;73:6647–58. DOIPubMedGoogle Scholar
- Barbour AG, Maupin GO, Teltow GJ, Carter CJ, Piesman J. Identification of an uncultivable Borrelia species in the hard tick Amblyomma americanum: possible agent of a Lyme disease-like illness. J Infect Dis. 1996;173:403–9. DOIPubMedGoogle Scholar
- Eads RB, Henderson HE, McGregor T, Irons JV. Relapsing fever in Texas; distribution of laboratory confirmed cases and the arthropod reservoirs. Am J Trop Med Hyg. 1950;30:73–6. DOIPubMedGoogle Scholar
- Brumpt E. Study of Spirochaeta turicatae, n. sp., agent of sporadic recurrent fever of the United States transmitted by Ornithodoros turicata [in French]. Comptes Rendus des Séances de la Société de Biologie et de ses Filiales (Paris). 1933;13:1369.
- Whitney MS, Schwan TG, Sultemeier KB, McDonald PS, Brillhart MN. Spirochetemia caused by Borrelia turicatae infection in 3 dogs in Texas. Vet Clin Pathol. 2007;36:212–6. DOIPubMedGoogle Scholar
- Francis E. Longevity of the tick Ornithodoros turicata and of Spirochaeta recurrentis with this tick. Public Health Rep. 1938;53:2220–41. DOIGoogle Scholar
- Dworkin MS, Shoemaker PC, Fritz CL, Dowell ME, Anderson DE Jr. The epidemiology of tick-borne relapsing fever in the United States. Am J Trop Med Hyg. 2002;66:753–8. DOIPubMedGoogle Scholar
Page created: October 16, 2018
Page updated: October 16, 2018
Page reviewed: October 16, 2018
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.