Volume 24, Number 8—August 2018
Dispatch
Direct Detection of penA Gene Associated with Ceftriaxone-Resistant Neisseria gonorrhoeae FC428 Strain by Using PCR
Table 1
Designation | Oligonucleotide sequence, 5′ → 3′ |
---|---|
Forward primer | CGCAACCGTGCCGTT |
Reverse primer | GGGTATTGAATGTGTCTGTTGGA |
Probe 1 | Fam-TTCA+T+G+A+CA+G+AAC-Iowa Black FQ |
Probe 2 | Hex-TCA+T+G+G+CA+GA-Iowa Black FQ |
*LNA bases are indicated by + preceding the base in the sequence.
Page created: July 18, 2018
Page updated: July 18, 2018
Page reviewed: July 18, 2018
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.