Human monocytic ehrlichiosis (HME) is an acute, febrile, tickborne disease caused by the bacterium Ehrlichia chaffeensis. HME was first reported in the United States in 1986 (1), and >1,000 ehrlichiosis cases have been reported annually since 2012 (https://www.cdc.gov/ehrlichiosis/stats/index.html). In Asia, however, only a limited number of HME cases have been reported in 3 countries (Thailand, South Korea, and China) (2–4).

Clinical manifestations of HME range from mild febrile illness to severe multiple organ failure. The most common symptoms of HME are fever, headache, myalgia, malaise, nausea, vomiting, diarrhea, and abdominal pain (5–7), which are difficult to differentiate from the symptoms of other febrile infectious diseases. Therefore, HME must be confirmed by laboratory diagnosis.

Although HME has not been documented in Taiwan, serologic evidence of Ehrlichia spp. has been detected in small mammals, such as Rattus norvegicus, R. losea, and Bandicota indica rats that are found around international and local harbors (8). In addition, Haemaphysalis flava ticks infected with Ehrlichia spp. have been collected from pale thrush birds (Turdus pallidus) and identified in Taiwan (9). We report an autochthonous human case of E. chaffeensis infection in Taiwan.

In mid-July 2018, a 66-year-old woman living in the Namaxia District of Kaohsiung City in southern Taiwan was admitted to Kaohsiung Chang Gung Memorial Hospital with a 5-day history of intermittent fever (39.8°C), chills, myalgias, malaise, mild dyspnea, and diffuse abdominal pain. The patient had underlying hypertension, type 2 diabetes mellitus, alcoholic fatty liver, and gastroesophageal reflux disease. Laboratory examinations at admission showed that the patient had thrombocytopenia; lymphocytopenia; elevated levels of C-reactive protein, aspartate aminotransferase, alanine aminotransferase, and creatinine; and an increased number of polymorphonuclear leukocytes (Table). Whole blood counts were within reference ranges, and no leukocytopenia was observed. A chest radiograph showed mild infiltration over the bilateral lower lung fields. Laboratory tests for dengue, influenza A and B, hepatitis A, hepatitis B, and hepatitis C viruses were all negative. She was admitted under the impression of atypical infection and thrombocytopenia.

The patient is a coffee farmer who lives in a rural region in Kaohsiung. Although she claimed not to have received arthropod or animal bites, small mammals and birds had often been seen around her workplace and house. Therefore, arthropodborne rickettsial diseases were suspected, and oral doxycycline (100 mg every 12 h) for 4 days and intravenous ceftriaxone (1 g every 12 h) for 7 days were prescribed as empirical therapy on the patient’s first day at the hospital. Because ehrlichial infection had not been confirmed during hospitalization, the patient was discharged with a prescription (500 mg cefadroxil monohydrate every 12 h) to be taken for 5 days because of suspicion of atypical bacterial infection.

Blood specimens collected from the patient on day 6 (acute-phase specimens) and day 20 (convalescent-phase specimens) after illness onset were sent to the Taiwan Centers for Disease Control (Taipei, Taiwan) for laboratory diagnosis of zoonotic diseases. DNA extracted from acute-phase blood specimens using the QIAamp DNA blood Mini Kit (QIAGEN GmbH, https://www.qiagen.com) was used to detect Ehrlichia chaffeensis infection using a primer set targeting ehrlichial 16S rRNA gene (forward primer: AGCGGCTATCTGGTTCGA; reverse primer: CATGCTCCACCGCTTGTG) and an E. chaffeensis–specific primer set targeting the nitrogen assimilation regulatory protein (ntrX) gene (forward primer: TGCCGGTAGATATAGTATCGA; reverse primer: ATTTGCGATGAAGTGCGG) by QuantiNova SYBR green real-time PCR (QIAGEN). The PCR products of 16S rRNA (182 bp; GenBank accession no. MN088851) and the ntrX gene sequence (153 bp; GenBank accession no. MN096569) were determined and analyzed. The sequence was 100% homologous with the sequences of E. chaffeensis strains, including the Arkansas, Jax, Saint Vincent, West Paces, Wakulla, Osceola, Liberty, and Heartland strains. The PCR results were negative for Coxiella burnetii, Orientia tsutsugamushi, typhus group rickettsiae, spotted fever group rickettsiae, and Anaplasma phagocytophilum (Appendix Table). Paired (acute- and convalescent-phase) serum samples were used to detect antibodies against E. chaffeensis by using indirect immunofluorescence assay according to the manufacturer’s recommendation (Focus Diagnostics, https://www.focusdx.com). IgG against E. chaffeensis showed seroconversion (titers ranging from <1:16 to 1:256) of the paired serum samples. IgG against Coxiella burnetii, Orientia tsutsugamushi, typhus group rickettsiae, spotted fever group rickettsiae, and Anaplasma phagocytophilum were all negative. The results of the microscopic agglutination test and the isolation of Leptospira sp. were also negative.

The presence of an HME case highlights the need for further studies of the prevalence, geographic distribution, and control of this disease in Taiwan. Human monocytic ehrlichiosis patients with immunosuppressive conditions, such as diabetes, might have a higher risk for hospitalization and life-threatening complications (10). In this case, the suspicion of rickettsial infection was based on the patient’s potential exposure to arthropodborne pathogens at her workplace and home, and the patient responded quickly to doxycycline treatment. Physician awareness of HME and early diagnosis and treatment are essential to improve disease outcomes.

Top