Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 25, Number 3—March 2019

Dispatch

In Vivo Selection of a Unique Tandem Repeat Mediated Azole Resistance Mechanism (TR120) in Aspergillus fumigatus cyp51A, Denmark

Rasmus K. HareComments to Author , Jan B. Gertsen, Karen M.T. Astvad, Kristine B. Degn, Anders Løkke, Marc Stegger, Paal S. Andersen, Lise Kristensen, and Maiken C. ArendrupComments to Author 
Author affiliations: Statens Serum Institut, Copenhagen, Denmark (R.K. Hare, K.M.T. Astvad, M. Stegger, P.S. Andersen, M.C. Arendrup); Åarhus University Hospital, Åarhus, Denmark (J.B. Gertsen, K.B. Degn, A. Løkke, L. Kristensen); Rigshospitalet, Copenhagen (M.C. Arendrup); University of Copenhagen, Copenhagen (M.C. Arendrup)

Main Article

Table

Aspergillus fumigatus strain characteristics, antimicrobial susceptibility, and molecular data, Denmark, 2013*

Isolate no. EUCAST-based susceptibility MICs, mg/L
Sanger sequencing: Cyp51A profile§ STRAf assay genotyping data:† 2A-2B-2C-3A-3B-3C-4A-4B-4C WGS data:‡ SNP differences compared with P-1
VRZ ITZ POS
P-1 1 0.5 0.125 F46Y/M172V/E427K 10–13–10–17–13–8–7–5–6 0
P-2 4 16 0.5 TR120/F46Y/M172V/E427K 10–13–10–17–13–8–7–5–6 NA
P-3 4 >16 0.5 TR120/F46Y/M172V/E427K 10–13–10–17–13–8–7–5–6 41
SSI-5197 1 1 0.125 F46Y/M172V/E427K 10-15-10-28-13-11-7-5-6 4,968
SSI-7413 0.5 0.25 0.125 WT 21–25–19–28–12–6–20–10–8 105,900
Af293 (13) 1 0.5 0.06 F46Y/M172V/N248T/D255E/E427K 26–18–18–46–21–23–11–10–8 102,727
SSI-5946 4 >16 0.5 TR34/L98H 20–21–12–84–10–7–8–9–10 108,901
SSI-5717 >4 0.5 0.25 TR46/Y121F/T289A 26–21–16–32–9–10–8–14–10 108,882

*ITZ, itraconazole; NA, not available; POS, posaconazole; SNP, single-nucleotide polymorphism; STRAf, short tandem repeat Aspergillus fumigatus; VRZ, voriconazole (isavuconazole MICs were equivalent, data not shown); WGS, whole-genome sequencing; WT, wild-type.
†STRAf genotyping was performed as previously described (3). Underlined STRAf markers are shared with P-1.
‡Reference genome coverage ranged from 88.5% to 90.93%. Sequencing depth based on all assembled contigs >1,000 bp ranged from 57.2× to 80.7×; 71.1× for P-1; and 66.3× for P-3.
§TR34: GAATCACGCGGTCCGGATGTGTGCTGAGCCGAAT, TR46: AGTTGTCTAGAATCACGCGGTCCGGATGTGTGCTGAGCCGAATGAA,
TR120: TTCTCCTCTAGAAAAAACTCATGAGTGAATAATCGCAGCACCACTCCAGAGTTGTCTAGAATCACGCGGTCCGGATGTGTGCTGAGCCGAATGAAAGTTGCCTAATTACTAAGGTGTAGT. GenBank accession numbers are MG972983 with TR120 and MG972984 without TR120.

Main Article

References
  1. Meis  JF, Chowdhary  A, Rhodes  JL, Fisher  MC, Verweij  PE. Clinical implications of globally emerging azole resistance in Aspergillus fumigatus. Philos Trans R Soc Lond B Biol Sci. 2016;371:20150460. DOIPubMedGoogle Scholar
  2. Subcommittee on Antifungal Susceptibility Testing of the ESCMID European Committee for Antimicrobial Susceptibility Testing. EUCAST Technical Note on the method for the determination of broth dilution minimum inhibitory concentrations of antifungal agents for conidia-forming moulds. Clin Microbiol Infect. 2008;14:982–4. DOIPubMedGoogle Scholar
  3. de Valk  HA, Meis  JF, Curfs  IM, Muehlethaler  K, Mouton  JW, Klaassen  CHW. Use of a novel panel of nine short tandem repeats for exact and high-resolution fingerprinting of Aspergillus fumigatus isolates. J Clin Microbiol. 2005;43:4112–20. DOIPubMedGoogle Scholar
  4. Ballard  E, Melchers  WJG, Zoll  J, Brown  AJP, Verweij  PE, Warris  A. In-host microevolution of Aspergillus fumigatus: A phenotypic and genotypic analysis. Fungal Genet Biol. 2018;113:1–13. DOIPubMedGoogle Scholar
  5. Sahl  JW, Lemmer  D, Travis  J, Schupp  JM, Gillece  JD, Aziz  M, et al. NASP: an accurate, rapid method for the identification of SNPs in WGS datasets that supports flexible input and output formats. Microb Genom. 2016;2:e000074.
  6. Delcher  AL, Salzberg  SL, Phillippy  AM. Using MUMmer to identify similar regions in large sequence sets. Curr Protoc Bioinformatics 2003;00:10.3.1–10.3.18.
  7. Price  MN, Dehal  PS, Arkin  AP. FastTree 2—approximately maximum-likelihood trees for large alignments. PLoS One. 2010;5:e9490. DOIPubMedGoogle Scholar
  8. Snelders  E, Camps  SMT, Karawajczyk  A, Schaftenaar  G, Kema  GHJ, van der Lee  HA, et al. Triazole fungicides can induce cross-resistance to medical triazoles in Aspergillus fumigatus. PLoS One. 2012;7:e31801. DOIPubMedGoogle Scholar
  9. Zhang  J, Snelders  E, Zwaan  BJ, Schoustra  SE, Meis  JF, van Dijk  K, et al. A novel environmental azole resistance mutation in Aspergillus fumigatus and a possible role of sexual reproduction in its emergence. MBio. 2017;8:e00791–17. DOIPubMedGoogle Scholar
  10. Abdolrasouli  A, Rhodes  J, Beale  MA, Hagen  F, Rogers  TR, Chowdhary  A, et al. Genomic context of azole resistance mutations in Aspergillus fumigatus determined using whole-genome sequencing. MBio. 2015;6:e00536.PubMedGoogle Scholar
  11. Verweij  PE, Zhang  J, Debets  AJM, Meis  JF, van de Veerdonk  FL, Schoustra  SE, et al. In-host adaptation and acquired triazole resistance in Aspergillus fumigatus: a dilemma for clinical management. Lancet Infect Dis. 2016;16:e251–60. DOIPubMedGoogle Scholar
  12. Snelders  E, Karawajczyk  A, Schaftenaar  G, Verweij  PE, Melchers  WJG. Azole resistance profile of amino acid changes in Aspergillus fumigatus CYP51A based on protein homology modeling. Antimicrob Agents Chemother. 2010;54:2425–30. DOIPubMedGoogle Scholar
  13. Garcia-Rubio  R, Alcazar-Fuoli  L, Monteiro  MC, Monzon  S, Cuesta  I, Pelaez  T, et al. Insight into the significance of Aspergillus fumigatus cyp51A polymorphisms. Antimicrob Agents Chemother. 2018;62:e00241–18. DOIPubMedGoogle Scholar
  14. Snelders  E, Camps  SMT, Karawajczyk  A, Rijs  AJMM, Zoll  J, Verweij  PE, et al. Genotype-phenotype complexity of the TR46/Y121F/T289A cyp51A azole resistance mechanism in Aspergillus fumigatus. Fungal Genet Biol. 2015;82:129–35. DOIPubMedGoogle Scholar
  15. Gsaller  F, Hortschansky  P, Furukawa  T, Carr  PD, Rash  B, Capilla  J, et al. Sterol biosynthesis and azole tolerance is governed by the opposing actions of SrbA and the CCAAT binding complex. PLoS Pathog. 2016;12:e1005775. DOIPubMedGoogle Scholar

Main Article

Page created: February 19, 2019
Page updated: February 19, 2019
Page reviewed: February 19, 2019
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external