Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 26, Number 12—December 2020
Research

Flight-Associated Transmission of Severe Acute Respiratory Syndrome Coronavirus 2 Corroborated by Whole-Genome Sequencing

Hollie Speake, Anastasia Phillips, Tracie Chong, Chisha Sikazwe, Avram Levy, Jurissa Lang, Benjamin Scalley, David J. Speers, David W. Smith, Paul Effler, and Suzanne P. McEvoyComments to Author 
Author affiliations: University of Notre Dame, Fremantle, Western Australia, Australia (H. Speake); Metropolitan Communicable Disease Control, Perth, Western Australia, Australia (A. Phillips, T. Chong, B. Scalley, S.P. McEvoy); University of Western Australia, Perth (C. Sikazwe, A. Levy, D.J. Speers, P. Effler); PathWest Laboratory Medicine Western Australia, Nedlands, Western Australia, Australia (C. Sikazwe, A. Levy, D.J. Speers, D.W. Smith, J. Lang); Public Health Emergency Operations Centre, Perth (P. Effler)

Main Article

Table 1

Primers and probe sequences used for in-house diagnostic assays used to test persons with suspected SARS-CoV-2 infection after flight from Sydney to Perth, Australia, March 19, 2020

Oligonucleotide
 Sequence, 5¢®3¢
 Concentration, μM
BetaCoV_Wuhan_F22595 (forward) TGAAGTTTTTAACGCCACCAGAT 0.7
BetaCoV_Wuhan_R22662 (reverse) CACAGTTGCTGATTCTCTTCCTGTT 0.9
BetaCoV_Wuhan_P22619-HEX (hydrolysis probe) (HEX)C[+A][+A]GCAT[+A][+A]A[+C]AGATGCA(BHQ1) 0.3
MS2-105F (forward) GTCGACAATGGCGGAACTG 0.2
MS2-170R (reverse) TTCAGCGACCCCGTTAGC 0.5
MS2-127-VIC (hydrolysis probe) (VIC)ACGTGACTGTCGCCCCAAGCAACTT(QSY) 0.2

Main Article

Page created: September 23, 2020
Page updated: November 19, 2020
Page reviewed: November 19, 2020
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external