Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 27, Number 1—January 2021
Dispatch

Ocular Filariasis in Human Caused by Breinlia (Johnstonema) annulipapillata Nematode, Australia

Anson V. KoehlerComments to Author , Jennifer M.B. Robson, David M. Spratt, Joshua Hann, Ian Beveridge, Michael Walsh, Rodney McDougall, Mark Bromley, Anna Hume, Harsha Sheorey, and Robin B. Gasser
Author affiliations: University of Melbourne, Parkville, Victoria, Australia (A.V. Koehler, I. Beveridge, R.B. Gasser); Sullivan Nicolaides Pathology, Brisbane, Queensland, Australia (J.M.B. Robson, M. Walsh, R. McDougall, M. Bromley, A. Hume); Australian National Wildlife Collection, Commonwealth Scientific and Industrial Research Organisation, Canberra, Australian Capital Territory, Australia (D.M. Spratt); Eastside Eye Specialist Care, Carindale, Queensland, Australia (J. Hann); St. Vincent’s Hospital, Melbourne, Victoria, Australia (H. Sheorey)

Main Article

Table

Primer sequences used in PCR of the amplification regions of the SSU or cox-1 genes of Breinlia sp. nematodes from a patient with ocular filariasis, Brisbane, Queensland, Australia, 2019*

Designation Primer pair Oligonucleotide sequence, 5¢ → 3¢ Annealing temperature, °C (time)† Expected size, bp Reference
SSU
1° PCR
 F18ScF1 ACCGCCCTAGTTCTGACCGTAAA 58 (45 s)
 830
 (6)
F18ScR1
 GGTTCAAGCCACTGCGATTAAAGC
cox-1
1° PCR FCo1extdF1 TATAATTCTGTTYTDACTA 52 (45 s) 970 (6)
FCo1extdR1 ATGAAAATGAGCYACWACATAA
2° PCR COIintF TGATTGGTGGTTTTGGTAA 52 (45 s) 650 (7)
COIintR ATAAGTACGAGTATCAATATC

* cox-1, cytochrome c oxidase subunit 1; SSU small subunit of nuclear ribosomal RNA.
†All PCRs used 35 cycles with an initial denaturation at 94°C for 5 min, all subsequent denaturation cycles were 30 s, and all extensions were 1 min.

Main Article

References
  1. Otranto  D, Eberhard  ML. Zoonotic helminths affecting the human eye. Parasit Vectors. 2011;4:41. DOIPubMedGoogle Scholar
  2. Beaver  PC. Intraocular filariasis: a brief review. Am J Trop Med Hyg. 1989;40:40–5. DOIPubMedGoogle Scholar
  3. Bain  O, Otranto  D, Diniz  DG, dos Santos  JN, de Oliveira  NP, Frota de Almeida  IN, et al. Human intraocular filariasis caused by Pelecitus sp. nematode, Brazil. Emerg Infect Dis. 2011;17:867–9. DOIPubMedGoogle Scholar
  4. Winkler  S, Pollreisz  A, Georgopoulos  M, Bagò-Horvath  Z, Auer  H, To  KK-W, et al. Candidatus Dirofilaria hongkongensis as causative agent of human ocular filariosis after travel to India. Emerg Infect Dis. 2017;23:1428–31. DOIPubMedGoogle Scholar
  5. Orr  B, Ma  G, Koh  WL, Malik  R, Norris  JM, Westman  ME, et al. Pig-hunting dogs are an at-risk population for canine heartworm (Dirofilaria immitis) infection in eastern Australia. Parasit Vectors. 2020;13:69. DOIPubMedGoogle Scholar
  6. Lefoulon  E, Bain  O, Bourret  J, Junker  K, Guerrero  R, Cañizales  I, et al. Shaking the tree: multi-locus sequence typing usurps current onchocercid (filarial nematode) phylogeny. PLoS Negl Trop Dis. 2015;9:e0004233. DOIPubMedGoogle Scholar
  7. Casiraghi  M, Anderson  TJ, Bandi  C, Bazzocchi  C, Genchi  C. A phylogenetic analysis of filarial nematodes: comparison with the phylogeny of Wolbachia endosymbionts. Parasitology. 2001;122:93–103. DOIPubMedGoogle Scholar
  8. Koehler  AV, Haydon  SR, Jex  AR, Gasser  RB. Cryptosporidium and Giardia taxa in faecal samples from animals in catchments supplying the city of Melbourne with drinking water (2011 to 2015). Parasit Vectors. 2016;9:315. DOIPubMedGoogle Scholar
  9. Kerkenezov  N. Intra-ocular filariasis in Australia. Br J Ophthalmol. 1962;46:607–15. DOIPubMedGoogle Scholar
  10. Moorhouse  DE. Dirofilaria immitis: a cause of human intra-ocular infection. Infection. 1978;6:192–3. DOIPubMedGoogle Scholar
  11. Boreham  RE, Cooney  PT, Stewart  PA. Dirofilariasis with conjunctival inflammation. Med J Aust. 1997;167:51. DOIPubMedGoogle Scholar
  12. Chong  EW, Sheorey  H, Lo  CH, Spratt  DM, Graue-Hernández  E. Subconjunctival dog heartworm. Med J Aust. 2010;193:184. DOIPubMedGoogle Scholar
  13. Huynh  T, Thean  J, Maini  R. Dipetalonema reconditum in the human eye. Br J Ophthalmol. 2001;85:1391–2. DOIPubMedGoogle Scholar
  14. Spratt  DM. New records of filarioid nematodes (Nematoda: Filarioidea) parasitic in Australasian monotremes, marsupials and murids, with descriptions of nine new species. Zootaxa. 2011;2860:1–61. DOIGoogle Scholar

Main Article

Page created: September 17, 2020
Page updated: December 21, 2020
Page reviewed: December 21, 2020
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external