Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 29, Number 1—January 2023

Research

Molecular Tools for Early Detection of Invasive Malaria Vector Anopheles stephensi Mosquitoes

Om P. SinghComments to Author , Taranjeet Kaur, Gunjan Sharma, Madhavinadha P. Kona, Shobhna Mishra, Neera Kapoor, and Prashant K. Mallick
Author affiliations: National Institute of Malaria Research, New Delhi, India (O.P. Singh, T. Kaur, G. Sharma, M.P. Kona, S. Mishra, P.K. Mallick); Indira Gandhi National Open University, New Delhi (N. Kapoor)

Main Article

Table 1

Sequences of primers and probes used in study of molecular tools for early detection of invasive malaria vector Anopheles stephensi mosquitoes

Name Sequence, 5′ → 3′ Annealing specificity Reference
Stq-F TCTTTCCTCGCATCCAGTTG An. stephensi This study
Stq-R CGGGAGAAGCGGTGATAAAT An. stephensi This study
Stq-P /56-FAM/CGTGCTAAC/ZEN/CTCACTCACCCACAC/3IABKFQ/ An. stephensi This study
Uq-F GAGATTCCCTCTGTCCCTATCT Universal This study
Uq-R AGCTCAACAGGGTCTTCTTTC Universal This study
Uq-P /5HEX/TAGCGAAAC/ZEN/CACAGCCAAGGGAA/3IABKFQ/ Universal This study
U5.8S-F ATCACTCGGCTCATGGATCG Universal (15)
St-F CGTATCTTTCCTCGCATCCA An. stephensi This study
UD2-R GCACTATCAAGCAACACGACT Universal This study
StD2-R GTCTGCCACCACAGTCCT An. stephensi This study

Main Article

References
  1. Sharma  SK, Hamzakoya  KK. ‎ Geographical spread of Anopheles stephensi vector of urban malaria, and Aedes aegypti, vector of dengue/DHF, in the Arabian Sea Islands of Lakshadweep, India. Dengue Bulletin. 2001;25:88–91. WHO Regional Office for South-East Asia [cited 2020 Nov 24]. https://apps.who.int/iris/handle/10665/148798
  2. Gad  AM. Anopheles stephensi liston in Egypt, UAR. Mosq News. 1967;27:171–4.
  3. Faulde  MK, Rueda  LM, Khaireh  BA. First record of the Asian malaria vector Anopheles stephensi and its possible role in the resurgence of malaria in Djibouti, Horn of Africa. Acta Trop. 2014;139:39–43. DOIPubMedGoogle Scholar
  4. Carter  TE, Yared  S, Gebresilassie  A, Bonnell  V, Damodaran  L, Lopez  K, et al. First detection of Anopheles stephensi Liston, 1901 (Diptera: culicidae) in Ethiopia using molecular and morphological approaches. Acta Trop. 2018;188:180–6. DOIPubMedGoogle Scholar
  5. Balkew  M, Mumba  P, Dengela  D, Yohannes  G, Getachew  D, Yared  S, et al. Geographical distribution of Anopheles stephensi in eastern Ethiopia. Parasit Vectors. 2020;13:35. DOIPubMedGoogle Scholar
  6. Gayan Dharmasiri  AG, Perera  AY, Harishchandra  J, Herath  H, Aravindan  K, Jayasooriya  HTR, et al. First record of Anopheles stephensi in Sri Lanka: a potential challenge for prevention of malaria reintroduction. Malar J. 2017;16:326. DOIPubMedGoogle Scholar
  7. Takken  W, Lindsay  S. Increased threat of urban malaria from Anopheles stephensi mosquitoes, Africa. Emerg Infect Dis. 2019;25:1431–3. DOIPubMedGoogle Scholar
  8. Sinka  ME, Pironon  S, Massey  NC, Longbottom  J, Hemingway  J, Moyes  CL, et al. A new malaria vector in Africa: Predicting the expansion range of Anopheles stephensi and identifying the urban populations at risk. Proc Natl Acad Sci U S A. 2020;117:24900–8. DOIPubMedGoogle Scholar
  9. World Health Organizaton. Vector alert: Anopheles stephensi invasion and spread. 2019. WHO reference number: WHO/HTM/GMP/2019.09 [cited 2020 Nov 24]. https://apps.who.int/iris/rest/bitstreams/1242915/retrieve
  10. Christophers  SR. The fauna of British India, including Ceylon and Burma. Diptera. 4. Family Culicidae, Tribe Anophelini. London: Taylor and Francis; 1933.
  11. Ahmed  A, Khogali  R, Elnour  MB, Nakao  R, Salim  B. Emergence of the invasive malaria vector Anopheles stephensi in Khartoum State, Central Sudan. [Erratum in: Parasit Vectors. 2021;14:562]. Parasit Vectors. 2021;14:511. DOIPubMedGoogle Scholar
  12. Singh  OP, Mishra  S, Sharma  G, Sindhania  A, Kaur  T, Sreehari  U, et al. Evaluation of intron-1 of odorant-binding protein-1 of Anopheles stephensi as a marker for the identification of biological forms or putative sibling species. PLoS One. 2022;17:e0270760. DOIPubMedGoogle Scholar
  13. Sharma  G, Lather  M, Singh  OP. Variations in palpal ornamentation of Anopheles fluviatilis species T and U (Diptera: Culicidae) and their taxonomic consequence. Indian J Exp Biol. 2020;58:64–8. DOIGoogle Scholar
  14. Mishra  S, Sharma  G, Das  MK, Pande  V, Singh  OP. Intragenomic sequence variations in the second internal transcribed spacer (ITS2) ribosomal DNA of the malaria vector Anopheles stephensi. PLoS One. 2021;16:e0253173. DOIPubMedGoogle Scholar
  15. Manonmani  A, Townson  H, Adeniran  T, Jambulingam  P, Sahu  S, Vijayakumar  T. rDNA-ITS2 polymerase chain reaction assay for the sibling species of Anopheles fluviatilis. Acta Trop. 2001;78:3–9. DOIPubMedGoogle Scholar
  16. Kumar  A, Rai  KS. Chromosomal localization and copy number of 18S + 28S ribosomal RNA genes in evolutionarily diverse mosquitoes (Diptera, Culicidae). Hereditas. 1990;113:277–89. DOIPubMedGoogle Scholar
  17. Walter  SD, Hildreth  SW, Beaty  BJ. Estimation of infection rates in population of organisms using pools of variable size. Am J Epidemiol. 1980;112:124–8. DOIPubMedGoogle Scholar
  18. Akane  A, Matsubara  K, Nakamura  H, Takahashi  S, Kimura  K. Identification of the heme compound copurified with deoxyribonucleic acid (DNA) from bloodstains, a major inhibitor of polymerase chain reaction (PCR) amplification. J Forensic Sci. 1994;39:362–72. DOIPubMedGoogle Scholar
  19. Boncristiani  H, Li  J, Evans  J, Pettis  J, Chen  Y. Scientific note on PCR inhibitors in the compound eyes of honey bees, Apis mellifera. Apidologie (Celle). 2011;42:457–60. DOIGoogle Scholar

Main Article

Page created: November 10, 2022
Page updated: December 21, 2022
Page reviewed: December 21, 2022
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external