Volume 29, Number 1—January 2023
Research
Molecular Tools for Early Detection of Invasive Malaria Vector Anopheles stephensi Mosquitoes
Table 1
Sequences of primers and probes used in study of molecular tools for early detection of invasive malaria vector Anopheles stephensi mosquitoes
Name | Sequence, 5′ → 3′ | Annealing specificity | Reference |
---|---|---|---|
Stq-F | TCTTTCCTCGCATCCAGTTG | An. stephensi | This study |
Stq-R | CGGGAGAAGCGGTGATAAAT | An. stephensi | This study |
Stq-P | /56-FAM/CGTGCTAAC/ZEN/CTCACTCACCCACAC/3IABKFQ/ | An. stephensi | This study |
Uq-F | GAGATTCCCTCTGTCCCTATCT | Universal | This study |
Uq-R | AGCTCAACAGGGTCTTCTTTC | Universal | This study |
Uq-P | /5HEX/TAGCGAAAC/ZEN/CACAGCCAAGGGAA/3IABKFQ/ | Universal | This study |
U5.8S-F | ATCACTCGGCTCATGGATCG | Universal | (15) |
St-F | CGTATCTTTCCTCGCATCCA | An. stephensi | This study |
UD2-R | GCACTATCAAGCAACACGACT | Universal | This study |
StD2-R | GTCTGCCACCACAGTCCT | An. stephensi | This study |
References
- Sharma SK, Hamzakoya KK. Geographical spread of Anopheles stephensi vector of urban malaria, and Aedes aegypti, vector of dengue/DHF, in the Arabian Sea Islands of Lakshadweep, India. Dengue Bulletin. 2001;25:88–91. WHO Regional Office for South-East Asia [cited 2020 Nov 24]. https://apps.who.int/iris/handle/10665/148798
- Gad AM. Anopheles stephensi liston in Egypt, UAR. Mosq News. 1967;27:171–4.
- Faulde MK, Rueda LM, Khaireh BA. First record of the Asian malaria vector Anopheles stephensi and its possible role in the resurgence of malaria in Djibouti, Horn of Africa. Acta Trop. 2014;139:39–43. DOIPubMedGoogle Scholar
- Carter TE, Yared S, Gebresilassie A, Bonnell V, Damodaran L, Lopez K, et al. First detection of Anopheles stephensi Liston, 1901 (Diptera: culicidae) in Ethiopia using molecular and morphological approaches. Acta Trop. 2018;188:180–6. DOIPubMedGoogle Scholar
- Balkew M, Mumba P, Dengela D, Yohannes G, Getachew D, Yared S, et al. Geographical distribution of Anopheles stephensi in eastern Ethiopia. Parasit Vectors. 2020;13:35. DOIPubMedGoogle Scholar
- Gayan Dharmasiri AG, Perera AY, Harishchandra J, Herath H, Aravindan K, Jayasooriya HTR, et al. First record of Anopheles stephensi in Sri Lanka: a potential challenge for prevention of malaria reintroduction. Malar J. 2017;16:326. DOIPubMedGoogle Scholar
- Takken W, Lindsay S. Increased threat of urban malaria from Anopheles stephensi mosquitoes, Africa. Emerg Infect Dis. 2019;25:1431–3. DOIPubMedGoogle Scholar
- Sinka ME, Pironon S, Massey NC, Longbottom J, Hemingway J, Moyes CL, et al. A new malaria vector in Africa: Predicting the expansion range of Anopheles stephensi and identifying the urban populations at risk. Proc Natl Acad Sci U S A. 2020;117:24900–8. DOIPubMedGoogle Scholar
- World Health Organizaton. Vector alert: Anopheles stephensi invasion and spread. 2019. WHO reference number: WHO/HTM/GMP/2019.09 [cited 2020 Nov 24]. https://apps.who.int/iris/rest/bitstreams/1242915/retrieve
- Christophers SR. The fauna of British India, including Ceylon and Burma. Diptera. 4. Family Culicidae, Tribe Anophelini. London: Taylor and Francis; 1933.
- Ahmed A, Khogali R, Elnour MB, Nakao R, Salim B. Emergence of the invasive malaria vector Anopheles stephensi in Khartoum State, Central Sudan. [Erratum in: Parasit Vectors. 2021;14:562]. Parasit Vectors. 2021;14:511. DOIPubMedGoogle Scholar
- Singh OP, Mishra S, Sharma G, Sindhania A, Kaur T, Sreehari U, et al. Evaluation of intron-1 of odorant-binding protein-1 of Anopheles stephensi as a marker for the identification of biological forms or putative sibling species. PLoS One. 2022;17:
e0270760 . DOIPubMedGoogle Scholar - Sharma G, Lather M, Singh OP. Variations in palpal ornamentation of Anopheles fluviatilis species T and U (Diptera: Culicidae) and their taxonomic consequence. Indian J Exp Biol. 2020;58:64–8. DOIGoogle Scholar
- Mishra S, Sharma G, Das MK, Pande V, Singh OP. Intragenomic sequence variations in the second internal transcribed spacer (ITS2) ribosomal DNA of the malaria vector Anopheles stephensi. PLoS One. 2021;16:
e0253173 . DOIPubMedGoogle Scholar - Kumar A, Rai KS. Chromosomal localization and copy number of 18S + 28S ribosomal RNA genes in evolutionarily diverse mosquitoes (Diptera, Culicidae). Hereditas. 1990;113:277–89. DOIPubMedGoogle Scholar
- Walter SD, Hildreth SW, Beaty BJ. Estimation of infection rates in population of organisms using pools of variable size. Am J Epidemiol. 1980;112:124–8. DOIPubMedGoogle Scholar
- Akane A, Matsubara K, Nakamura H, Takahashi S, Kimura K. Identification of the heme compound copurified with deoxyribonucleic acid (DNA) from bloodstains, a major inhibitor of polymerase chain reaction (PCR) amplification. J Forensic Sci. 1994;39:362–72. DOIPubMedGoogle Scholar
- Boncristiani H, Li J, Evans J, Pettis J, Chen Y. Scientific note on PCR inhibitors in the compound eyes of honey bees, Apis mellifera. Apidologie (Celle). 2011;42:457–60. DOIGoogle Scholar
Page created: November 10, 2022
Page updated: December 21, 2022
Page reviewed: December 21, 2022
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.