Volume 29, Number 4—April 2023
Research Letter
Rickettsia conorii Subspecies israelensis in Captive Baboons
Table
PCR protocols used in study of vector-borne pathogens among baboons, Italy, 2020
Pathogen | Target gene | Primer | Sequence, 5′ →3′ | Fragment length, bp | Reference |
---|---|---|---|---|---|
Babesia/Theileria spp. | 18S rRNA | RLB-F | GAGGTAGTGACAAGAAATAACAATA | 460–520 | (2) |
RLB-R |
TCTTCGATCCCCTAACTTTC |
||||
Ehrlichia/Anaplasma spp. | 16S rRNA | EHR-16SD | GGTACCYACAGAAGAAGTCC | 345 | (2) |
HER-16SR |
TAGCACTCATCGTTTACAGC |
||||
Rickettsia spp. | gltA | CS-78F | GCAAGTATCGGTGAGGATGTAAT | 401 | (2) |
CS-323R |
GCTTCCTTAAAATTCAATAAATCAGGAT |
||||
Spotted fever group Rickettsiae | ompA | Rr190.70F | ATGGCGAATATTTCTCCAAAA | 632 | (2) |
Rr190.701R | GTTCCGTTAATGGCAGCATCT | ||||
ompB | 120–2788 | AAACAATAATCAAGGTACTGT | 600 | (3) | |
120–3599 |
TACTTCCGGTTACAGCAAAGT |
||||
Leishmania infantum | kDNA minicircle | Leish-1 | AACTTTTCTGGTCCTCCG GGTAG | 120 | (4) |
Leish-2 | ACCCCCAGTTTCCCGCC |
References
- Nakayima J, Hayashida K, Nakao R, Ishii A, Ogawa H, Nakamura I, et al. Detection and characterization of zoonotic pathogens of free-ranging non-human primates from Zambia. Parasit Vectors. 2014;7:490. DOIPubMedGoogle Scholar
- Sgroi G, Iatta R, Lia RP, D’Alessio N, Manoj RRS, Veneziano V, et al. Spotted fever group rickettsiae in Dermacentor marginatus from wild boars in Italy. Transbound Emerg Dis. 2021;68:2111–20. DOIPubMedGoogle Scholar
- Roux V, Raoult D. Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer-membrane protein rOmpB (ompB). Int J Syst Evol Microbiol. 2000;50:1449–55. DOIPubMedGoogle Scholar
- Sgroi G, Iatta R, Veneziano V, Bezerra-Santos MA, Lesiczka P, Hrazdilová K, et al. Molecular survey on tick-borne pathogens and Leishmania infantum in red foxes (Vulpes vulpes) from southern Italy. Ticks Tick Borne Dis. 2021;12:
101669 . DOIPubMedGoogle Scholar - Maia C, Cristóvão JM, Pereira A, Parreira R, Campino L. Detection of Rickettsia conorii israelensis DNA in the blood of a cat and a dog from southern Portugal. Top Companion Anim Med. 2019;36:12–5. DOIPubMedGoogle Scholar
- Guccione C, Colomba C, Rubino R, Bonura C, Anastasia A, Agrenzano S, et al. A severe case of Israeli spotted fever with pleural effusion in Italy. Infection. 2022;50:269–72. DOIPubMedGoogle Scholar
- Torina A, Naranjo V, Pennisi MG, Patania T, Vitale F, Laricchiuta P, et al. Serologic and molecular characterization of tickborne pathogens in lions (Panthera leo) from the Fasano Safari Park, Italy. J Zoo Wildl Med. 2007;38:591–3. DOIPubMedGoogle Scholar
- Rovery C, Brouqui P, Raoult D. Questions on Mediterranean spotted fever a century after its discovery. Emerg Infect Dis. 2008;14:1360–7. DOIPubMedGoogle Scholar
- Akinyi MY, Tung J, Jeneby M, Patel NB, Altmann J, Alberts SC. Role of grooming in reducing tick load in wild baboons (Papio cynocephalus). Anim Behav. 2013;85:559–68. DOIPubMedGoogle Scholar
- Otranto D, Dantas-Torres F, Giannelli A, Latrofa MS, Cascio A, Cazzin S, et al. Ticks infesting humans in Italy and associated pathogens. Parasit Vectors. 2014;7:328. DOIPubMedGoogle Scholar
Page created: February 14, 2023
Page updated: March 21, 2023
Page reviewed: March 21, 2023
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.