Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 29, Number 4—April 2023
Research Letter

Rickettsia conorii Subspecies israelensis in Captive Baboons

Giovanni Sgroi, Roberta Iatta, Grazia Carelli, Annamaria Uva, Maria Alfonsa Cavalera, Piero Laricchiuta, and Domenico OtrantoComments to Author 
Author affiliations: Experimental Zooprophylactic Institute of Southern Italy, Portici, Italy (G. Sgroi); University of Bari Aldo Moro, Bari, Italy (G. Sgroi, R. Iatta, G. Carelli, A. Uva, M.A. Cavalera, D. Otranto); Zoosafari Park Fasano, Brindisi, Italy (P. Laricchiuta); Bu-Ali Sina University, Hamedan, Iran (D. Otranto)

Main Article

Table

PCR protocols used in study of vector-borne pathogens among baboons, Italy, 2020

Pathogen Target gene Primer Sequence, 5′ →3′ Fragment length, bp Reference
Babesia/Theileria spp. 18S rRNA RLB-F GAGGTAGTGACAAGAAATAACAATA 460–520 (2)
RLB-R
 TCTTCGATCCCCTAACTTTC
Ehrlichia/Anaplasma spp. 16S rRNA EHR-16SD GGTACCYACAGAAGAAGTCC 345 (2)
HER-16SR
 TAGCACTCATCGTTTACAGC
Rickettsia spp. gltA CS-78F GCAAGTATCGGTGAGGATGTAAT 401 (2)
CS-323R
 GCTTCCTTAAAATTCAATAAATCAGGAT
Spotted fever group Rickettsiae ompA Rr190.70F ATGGCGAATATTTCTCCAAAA 632 (2)
Rr190.701R GTTCCGTTAATGGCAGCATCT
ompB 120–2788 AAACAATAATCAAGGTACTGT 600 (3)
120–3599
 TACTTCCGGTTACAGCAAAGT
Leishmania infantum kDNA minicircle Leish-1 AACTTTTCTGGTCCTCCG GGTAG 120 (4)
Leish-2 ACCCCCAGTTTCCCGCC

Main Article

References
  1. Nakayima  J, Hayashida  K, Nakao  R, Ishii  A, Ogawa  H, Nakamura  I, et al. Detection and characterization of zoonotic pathogens of free-ranging non-human primates from Zambia. Parasit Vectors. 2014;7:490. DOIPubMedGoogle Scholar
  2. Sgroi  G, Iatta  R, Lia  RP, D’Alessio  N, Manoj  RRS, Veneziano  V, et al. Spotted fever group rickettsiae in Dermacentor marginatus from wild boars in Italy. Transbound Emerg Dis. 2021;68:2111–20. DOIPubMedGoogle Scholar
  3. Roux  V, Raoult  D. Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer-membrane protein rOmpB (ompB). Int J Syst Evol Microbiol. 2000;50:1449–55. DOIPubMedGoogle Scholar
  4. Sgroi  G, Iatta  R, Veneziano  V, Bezerra-Santos  MA, Lesiczka  P, Hrazdilová  K, et al. Molecular survey on tick-borne pathogens and Leishmania infantum in red foxes (Vulpes vulpes) from southern Italy. Ticks Tick Borne Dis. 2021;12:101669. DOIPubMedGoogle Scholar
  5. Maia  C, Cristóvão  JM, Pereira  A, Parreira  R, Campino  L. Detection of Rickettsia conorii israelensis DNA in the blood of a cat and a dog from southern Portugal. Top Companion Anim Med. 2019;36:12–5. DOIPubMedGoogle Scholar
  6. Guccione  C, Colomba  C, Rubino  R, Bonura  C, Anastasia  A, Agrenzano  S, et al. A severe case of Israeli spotted fever with pleural effusion in Italy. Infection. 2022;50:269–72. DOIPubMedGoogle Scholar
  7. Torina  A, Naranjo  V, Pennisi  MG, Patania  T, Vitale  F, Laricchiuta  P, et al. Serologic and molecular characterization of tickborne pathogens in lions (Panthera leo) from the Fasano Safari Park, Italy. J Zoo Wildl Med. 2007;38:591–3. DOIPubMedGoogle Scholar
  8. Rovery  C, Brouqui  P, Raoult  D. Questions on Mediterranean spotted fever a century after its discovery. Emerg Infect Dis. 2008;14:1360–7. DOIPubMedGoogle Scholar
  9. Akinyi  MY, Tung  J, Jeneby  M, Patel  NB, Altmann  J, Alberts  SC. Role of grooming in reducing tick load in wild baboons (Papio cynocephalus). Anim Behav. 2013;85:559–68. DOIPubMedGoogle Scholar
  10. Otranto  D, Dantas-Torres  F, Giannelli  A, Latrofa  MS, Cascio  A, Cazzin  S, et al. Ticks infesting humans in Italy and associated pathogens. Parasit Vectors. 2014;7:328. DOIPubMedGoogle Scholar

Main Article

Page created: February 14, 2023
Page updated: March 21, 2023
Page reviewed: March 21, 2023
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external