Volume 29, Number 5—May 2023
Dispatch
Emerging Invasive Group A Streptococcus M1UK Lineage Detected by Allele-Specific PCR, England, 20201
Table
PCR primers and conditions used to differentiate M1global and M1UK Streptococcus pyogenes lineages in study of emerging invasive group A Streptococcus M1UK lineage detected by allele-specific PCR, England, 2020*
| Target gene | Primer type† | Sequences‡ | PCR cycle conditions | Product, bp |
|---|---|---|---|---|
| rofA |
WT sequence | TGTTAATTGCTTGGTTAAATCA | 30 cycles of 95°C for 3 min, 45 s; 59.2°C for 30 s; 72°C for 1 min (final cycle: 5 min) |
278 |
| Forward-SNP | 5′-TGTTAATTGCTTGGTTAAAGtA-'3 | |||
| Forward-WT | 5′-TGTTAATTGCTTGGTTAAAGCA-'3 | |||
| Reverse |
5′-GCTCATCTCCTAACGGATTCTT-'3 |
|||
| gldA |
WT sequence | AGATGGGTTAGCAACATGG | 30 cycles of 95°C for 3 min, 45 s; 61.8°C for 30 s;72°C for 1 min (final cycle: 5 min) |
292 |
| Forward-SNP | 5′-AGATGGGTTAGCAACAAaG-'3 | |||
| Forward-WT | 5′-AGATGGGTTAGCAACAAGG-'3 | |||
| Reverse |
5′-GAATAGCACCTGTCAGCG-'3 |
|||
| pstB | WT sequence | GATAAATCAATCTTAGACCA | 30 cycles of 95°C for 3 min, 45 s; 50°C for 30 s; 72°C for 1 min (final cycle: 5 min) | 287 |
| Forward-SNP | 5′-GATAAATCAATCTTAGATaA-'3 | |||
| Forward-WT | 5′-GATAAATCAATCTTAGATCA-'3 | |||
| Reverse | 5′-CGTGAGGCTTGCTGCATTGAG-'3 |
*SNP, single-nucleotide polymorphism; WT, wild-type. †Forward primers were designed to detect either the targeted SNP (M1UK) or WT (M1global) sequences. ‡Lowercase bold letters in primer sequences denote the base complementary to the targeted SNP in the M1UK sequence. Underlined uppercase letters indicate an additional mismatched base introduced into primer sequences to increase primer specificity.
1Data from this study were presented at the 21st Lancefield International Symposium on Streptococci and Streptococcal Diseases; Stockholm, Sweden; June 7–10, 2022.