During May 24–July 15, 2022, a total of 66 samples (42 lesion swabs, 20 respiratory samples, and 4 blood samples) belonging to 41 adults (mean age 35.61 ± 11.25, range 17–60 years) and collected within 72 hours of illness onset were submitted in accordance with laboratory requirements (Table 1). All patients were located in a 30-km area around Oviedo, the capital of Asturias. In addition to MPXV, we also tested for herpes simplex virus, varicella zoster virus, enterovirus, human herpesvirus 8, molluscum contagiosum virus, and human papilloma virus, according to clinical manifestations. Samples were processed following laboratory protocols for nucleic acid detection, and 21 were inoculated onto monolayer conventional cell culture (MRC-5 cell, Vero-E6, and A549 and LLC-MK2 cells subcultures).

We extracted nucleic acids by using the automated nucleic acid purifier Magnapure 96 (Roche Diagnostics, https://www.roche.com). We performed orthopoxvirus group PCR (5) and specific MPXV in-house real-time qPCR.

For qPCR, we amplified 5 µL of extracted nucleic acids in a final volume of 10 µL, including the Brillant III Ultra-fast QPCR Master MIX (Agilent Technologies, https://www.agilent.com), 1,000 nm of each primer (MPXV-S, TGTTGACGCACCAGCGTCT; MPXV-A, AACAGTGGACCCTTGATGACTGT), and 200 nm of FAM-labeled MGB probe (CAATCCATGGTATTCGA; ABI, CA). We performed qPCR as follows: 95° for 7 min, 45 cycles of 95° for 5 min and 60° for 33 min. In addition, we quantified the human β-globin gene in each sample to evaluate sample quality and to calculate normalized viral load in log₁₀ copies per 10³ cells (6).

We detected MPXV in 23 (56.09%) of the 41 patients studied. All were men; the mean age was 38.13 + 9.42 years (range 22–56 years). At least 15 stated they had sex with men, and 12 were HIV-positive. We detected herpes simplex virus 1 in 2 persons (1 of whom was co-infected with MPXV) and varicella zoster virus 1 person. MPXV was detected in 25 (96.15%) lesion swab samples with a viral load of 7.58 + 2.03 (range 3.84–11.71 [95% CI 6.44–8.19]) and in 8 (66.66%) respiratory swab specimens with a viral load of 5.04 + 1.01 (range 3.5–6.23 [95% CI 4.192–5.88]; p = 0.0041).

Figure 1

Figure 1. Cytopathic effect in monkeypox virus–infected cells from patients in Asturias, Spain. A) MRC-5; B) Vero E6; C) A549; D) LLC-MK2. Original magnification ×10.

We isolated virus in 13 (81.25%) patients out of 16 infected persons inoculated. From those persons, we recovered MPXV in 17 (80%) of 21 samples assayed: 4 (80%) respiratory swab samples (3 from Vero-E6 and 1 from MRC-5 cells) and 13 (81.25%) lesion swab samples (13 from Vero-E6 cells and 11 from MRC-5 cells) (p = 0.68) (Table 2). In 6 subcultures in A549 cells and in LLC-MK2 cells, cytopathic effect was observed and confirmed by PCR (Figure 1).

Figure 2

Figure 2. Phylogenetic relationships of monkeypox virus strains from patients in Asturias, Spain (bold), and reference strains from GenBank and GISAID (https://www.gisaid.org). Alignment has 57 sequences with 262 nucleotides. Numbers...

We characterized the virus using Sanger sequencing method, and we purified then sequenced the PCR product by using BigDye Terminator v1.1 Cycle Sequencing Kit with an ABI PRISM 3700 DNA analyzer (both ThermoFisher Scientific, https://www.thermofisher.com). We analyzed the sequences subsequently obtained by using IQ-TREE multicore version 2.1.3 (http://www.iqtree.org). We performed tree reconstruction using best-fit model chosen according to Bayesian information criterion. We tested tree branches by the SH-like aLRT method with 1,000 replicates, generating 1,000 samples for ultrafast bootstrap (Figure 2).

In MPXV infection, human-to-human transmission can result from close contact with respiratory secretions, skin lesions of an infected person, or recently contaminated objects (7). In this study, all infected patients were men who had skin lesions. In <50% of cases, patients were experiencing fever, adenopathy, or malaise. Fifteen patients stated they had sex with men or engaged in high-risk sexual practices. In this study, 12 HIV-positive patients were infected with MPXV but did not have higher viral load (4). Only 2 patients were hospitalized. One patient had fever and severe lymphocytosis. The other was a renal transplant patient hospitalized mainly because of his immunosuppressed state. In that patient, the virus was detected for >1 week. In any case, all the patients had a positive outcome.

All viruses were characterized as clade II, similar to findings from other cases in Spain, suggesting the same focus of infection (S. Buenestado et al., unpub. data, https://virological.org/t/updatetwo-draft-genomes-from-madrid-spain-of-the-monkeypoxvirus-2022-outbreak/848). As expected, the disease followed a self-limited course, and no patients experienced severe complications. DNA sequencing also makes it possible to interpret transmission episodes and confirm the existence of endemic variants (8,9). Community transmission data were available for 10 cases. Only 2 were considered secondary cases, indicating that transmission in that environment at that point was not common but had started and could spread.

When possible, blood and pharyngeal or nasopharyngeal swabs were collected, per World Health Organization recommendations (7,10). Blood samples were only collected from 3 patients, and virus was detected in 2 of them at <4 log₁₀ copies/mL. Viremia occurs very early in the course of infection and usually contains a lower viral load than lesions. On the other hand, the normalized viral load was lower in respiratory swab samples than in lesion swab samples, which was to be expected. Patients sought care at a more advanced stage of infection, in which lesions are already present in different phases.

In this study, virus was easily recovered in standard cell culture (VeroE6, MRC-5) from samples with a real-time qPCR cycle threshold of <31 and ≈3.3 log₁₀ copies/10³ cells, according to a standard curve (6). Cytopathic effect appeared in <5 days. In addition, subcultures were achieved in other cell lines commonly used in the laboratory (A549 or LLC-MK2). Those data indicate that at higher viral loads, the virus is complete and transmissible, as has been demonstrated with other viruses such as SARS-CoV-2 (11). A limitation of this study was the lack of detailed clinical information for many patients.

In summary, MPXV requires rapid diagnosis and a rapid public health response. The designed real-time qRT-PCR and virus characterization proved very useful in diagnosing mpox and surveillance for MPXV and could aid in controlling the spread of infection and managing outbreaks. Furthermore, the use of culture can help confirm transmission.