Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 31, Number 10—October 2025

Dispatch

Detection of Monkeypox Virus Clade Ib DNA in Wastewater Solids at Wastewater Treatment Plants, United States

Alexandria B. BoehmComments to Author , Marlene K. Wolfe, Amanda L. Bidwell, Bradley J. White, Bridgette Shelden, and Dorothea Duong
Author affiliation: Author affiliations: Stanford University, Stanford, California, USA (A.B. Boehm, A.L. Bidwell); Emory University, Atlanta, Georgia, USA (M.K. Wolfe); Google LLC, Mountain View, California, USA (B.J. White); Verily Life Sciences LLC, South San Francisco, California, USA (B.J. White, B. Shelden, D. Duong)

Main Article

Table

Monkeypox virus clade Ib probe and primers used to detect mpox in wastewater solids at wastewater treatment plants, United States

Probe or primer
 Sequence, 5′→3′
Probe ATATTCAGGCGCATATCCACCCACGT
Forward primer AAGACTTCCAAACTTAATCACTCCT
Reverse primer CGTTTGATATAGGATGTGGACATTT

Main Article

Page created: August 15, 2025
Page updated: September 25, 2025
Page reviewed: September 25, 2025
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external