Volume 6, Number 2—April 2000
Research
Vibrio cholerae O139 in Calcutta, 1992-1998: Incidence, Antibiograms, and Genotypes
Table 1
Oligonucleotide primer sequences used in polymerase chain reaction assays of Vibrio cholerae O139
| Amplicon | |||
|---|---|---|---|
| Gene | Primer sequence (5'-3') | size | Ref. |
| ctxA | CTCAGACGGGATTTGTTAGGCACG | 301 | 14 |
| TCTATCTCTGTAGCCCCTATTACG | |||
| tcpA | GAAGAAGTTTGTAAAAGAAGAACAC | 471 | 14 |
| (El Tor) | GAAGGACCTTCTTTCACGTTG | ||
| tcpA | GATTGTGCGTCTTGCATTTAGG | 2200 | 16 |
| (classical) | GTGAATAAATCAGGTGTAATGTCG | ||
| ace | GCTTATGATGGACACCCTTTA | 284 | 15,a |
| TTTGCCCTGCGAGCGTTAAAC | |||
| zot | CACTGTTGGTGAGCGTTATCG | 243 | a |
| CAAGCGCTGTGGGTAGAAGTGAAA | |||
aThis study.
References
- Baumann P, Furniss AL, Lee JV. Bergey's manual of systematic bacteriology. Vol 1. In: Genus 1, Vibrio P. Klieg NR, Holt JG, editors. Baltimore: Williams and Wilkins; 1984. p. 518-38.
- Yamai S, Okitsu T, Shimada T, Katsube Y. Distribution of serogroups of Vibrio cholerae non-O1 non-O139 with specific reference to their ability to produce cholera toxin and addition of novel serogroups. Journal of Japanese Association of Infectious Diseases. 1997;71:1037–45.
- Ramamurthy T, Garg S, Sharma R, Bhattacharya SK, Nair GB, Shimada T, Emergence of a novel strain of Vibrio cholerae with epidemic potential in southern and eastern India. Lancet. 1993;341:703–4. DOIPubMedGoogle Scholar
- Nair GB, Ramamurthy T, Bhattacharya SK, Mukhopadhyay AK, Garg S, Bhattacharya MK, Spread of Vibrio cholerae O139 Bengal in India. J Infect Dis. 1994;169:1029–34.PubMedGoogle Scholar
- Nair GB, Albert MJ, Shimada T, Takeda Y. Vibrio cholerae O139 Bengal: the new serogroup causing cholera. Medical Microbiological Reviews. 1996;7:43–51.
- Sharma C, Nair GB, Mukhopadhyay AK, Bhattacharya SK, Ghosh RK, Ghosh A. Molecular characterization of V. cholerae O1 biotype El Tor strains isolated between 1992 and 1995 in Calcutta, India: evidence for the emergence of a new clone of the El Tor biotype. J Infect Dis. 1997;175:1134–41. DOIPubMedGoogle Scholar
- Mukhopadhyay AK, Garg S, Mitra R, Basu A, Dutta D, Bhattacharya SK, Temporal shifts in traits of Vibrio cholerae strains isolated from hospitalized patients in Calcutta: a 3-year (1993-1995) analysis. J Clin Microbiol. 1996;34:2537–43.PubMedGoogle Scholar
- Sharma C, Maiti S, Mukhopadhyay AK, Basu A, Basu I, Nair GB, Unique organization of the CTX genetic element in Vibrio cholerae O139 strains which reemerged in Calcutta, India, in September, 1996. J Clin Microbiol. 1997;35:3348–50.PubMedGoogle Scholar
- Kimsey H, Nair GB, Ghosh A, Waldor MK. Diverse CTX s and evolution of new pathogenic Vibrio cholerae. Lancet. 1998;353:457–8. DOIGoogle Scholar
- Mitra R, Basu A, Dutta D, Nair GB, Takeda Y. Resurgence of Vibrio cholerae O139 Bengal with altered antibiogram in Calcutta, India. Lancet. 1996;348:1181. DOIPubMedGoogle Scholar
- Mukhopadhyay AK, Basu A, Garg P, Bag PK, Ghosh A, Bhattacharya SK, Molecular epidemiology of reemergent Vibrio cholerae O139 Bengal in India. J Clin Microbiol. 1998;36:2149–52.PubMedGoogle Scholar
- World Health Organization. Guidelines for cholera control. Geneva: The Organization; 1993.
- Yamamoto T, Nair GB, Parodi CC, Takeda Y. In vitro susceptibilities to antimicrobial agents of V. cholerae O1 and O139. Antimicrob Agents Chemother. 1993;39:241–4.
- Keasler SP, Hall RH. Detecting and biotyping V. cholerae O1 with multiplex polymerase chain reaction. Lancet. 1993;341:1661. DOIPubMedGoogle Scholar
- Colombo MM, Mastrandrea S, Santona A, de Amdrade AP, Uzzau S, Rabino S, Distribution of the ace, zot, and ctxA toxin genes in the clinical and environmental Vibrio cholerae. J Infect Dis. 1994;170:750–1.PubMedGoogle Scholar
- Basu A, Mukhopadhyay AK, Sharma C, Jyot J, Gupta N, Ghosh A, Heterogeneity in the organization of the CTX genetic element in strains of Vibrio cholerae O139 Bengal isolated from Calcutta, India and Dhaka, Bangladesh and its plausible link to the dissimilar incidence of O139 cholera in the two locales. Microb Pathog. 1998;24:175–83. DOIPubMedGoogle Scholar
- Yamasaki S, Nair GB, Bhattacharya SK, Yamamoto S, Kurazono H, Takeda Y. Cryptic appearance of a new clone of Vibrio cholerae O1 biotype El Tor in Calcutta, India. Microbiol Immunol. 1997;41:1–6.PubMedGoogle Scholar
- Waldor MK, Mekalanos JJ. Vibrio cholerae O139 specific gene sequence. Lancet. 1994;343:1366. DOIPubMedGoogle Scholar
- Kaper JB, Morris JG Jr, Nishibuchi M. DNA probes for pathogenic Vibrio species. In: Tenover FC, editor. DNA probes for infectious disease. Boca Raton (FL): CRC Press, Inc.; 1992. p. 65-77.
- Murray MG, Thompson WF. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 1980;8:4321–5. DOIPubMedGoogle Scholar
- Pajni S, Sharma C, Bhasin N, Ghosh A, Ramamurthy T, Nair GB, Studies on the genesis of Vibrio cholerae O139: identification of probable progenitor strains. J Med Microbiol. 1994;42:20–5. DOIGoogle Scholar
- Bhadra RK, Roychoudhury S, Banerjee RK, Kar S, Majumdar R, Sengupta S, Cholera toxin (CTX) genetic element in Vibrio cholerae O139. Microbiology. 1995;141:1977–83. DOIPubMedGoogle Scholar
- Mekalanos JJ. Duplication and amplification of cholera toxin genes in Vibrio cholerae. Cell. 1983;35:253–63. DOIPubMedGoogle Scholar
- Waldor MK, Tschape H, Mekalanos JJ. A new type of conjugative transposon encodes resistance to sulfamethoxazole, trimethoprim and streptomycin in Vibrio cholerae O139. J Bacteriol. 1996;178:4157–65.PubMedGoogle Scholar
- Faruque SM, Alim ARMA, Rahman MM, Siddique AK, Sack RB, Albert MJ. Clonal relationships assay classical Vibrio cholerae O1 strains isolated between 1961 and 1992 in Bangladesh. J Clin Microbiol. 1993;31:2513–6.PubMedGoogle Scholar
- Faruque SM, Ahmed KM, Siddique AK, Zoman K, Alim ARMA, Albert MJ. Molecular analysis of toxigenic Vibrio cholerae in Bangladesh studied by numerical analysis of rRNA gene restriction patterns. J Clin Microbiol 1997;35.2299-306.
- Faruque SM, Roy SK, Alim ARMA, Siddique AK, Albert MJ. Molecular epidemiology of toxigenic Vibrio cholerae in Bangladesh studied by numerical analysis of rRNA gene restriction patterns. J Clin Microbiol. 1995;33:2833–8.PubMedGoogle Scholar
- Faruque SM, Ahmed KM, Alim ARMA, Qadri F, Siddique AK, Albert MJ. Emergence of a new clone of toxigenic Vibrio cholerae O1 biotype El Tor displacing V. cholerae O139 Bengal in Bangladesh. J Clin Microbiol. 1997;35:624–30.PubMedGoogle Scholar
- Faruque SM, Alim ARMA, Roy SK, Khan F, Nair GB, Sack RB, Molecular analysis of rRNA and cholera toxin genes carried by the new epidemic strain of toxigenic Vibrio cholerae O139 synonym Bengal. J Clin Microbiol. 1994;33:1050–3.
Page created: December 16, 2010
Page updated: December 16, 2010
Page reviewed: December 16, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.