Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 6, Number 2—April 2000
Research

Vibrio cholerae O139 in Calcutta, 1992-1998: Incidence, Antibiograms, and Genotypes

Arnab Basu*, Pallavi Garg*, Simanti Datta*, Soumen Chakraborty*, Tanuja Bhattacharya*, Asis Khan*, T. Ramamurthy*, S.K. Bhattacharya*, Shinji Yamasaki†, Yoshifumi Takeda‡, and G. Balakrish Nair*Comments to Author 
Author affiliations: *National Institute of Cholera and Enteric Diseases, Calcutta, India; †International Medical Center of Japan, Tokyo, Japan; and ‡National Institute of Infectious Diseases, Tokyo, Japan

Main Article

Table 1

Oligonucleotide primer sequences used in polymerase chain reaction assays of Vibrio cholerae O139

Amplicon
Gene Primer sequence (5'-3') size Ref.
ctxA CTCAGACGGGATTTGTTAGGCACG 301 14
TCTATCTCTGTAGCCCCTATTACG
tcpA GAAGAAGTTTGTAAAAGAAGAACAC 471 14
(El Tor) GAAGGACCTTCTTTCACGTTG
tcpA GATTGTGCGTCTTGCATTTAGG 2200 16
 (classical) GTGAATAAATCAGGTGTAATGTCG
ace GCTTATGATGGACACCCTTTA 284 15,a
TTTGCCCTGCGAGCGTTAAAC
zot CACTGTTGGTGAGCGTTATCG 243 a
CAAGCGCTGTGGGTAGAAGTGAAA

aThis study.

Main Article

References
  1. Baumann  P, Furniss  AL, Lee  JV. Bergey's manual of systematic bacteriology. Vol 1. In: Genus 1, Vibrio P. Klieg NR, Holt JG, editors. Baltimore: Williams and Wilkins; 1984. p. 518-38.
  2. Yamai  S, Okitsu  T, Shimada  T, Katsube  Y. Distribution of serogroups of Vibrio cholerae non-O1 non-O139 with specific reference to their ability to produce cholera toxin and addition of novel serogroups. Journal of Japanese Association of Infectious Diseases. 1997;71:1037–45.
  3. Ramamurthy  T, Garg  S, Sharma  R, Bhattacharya  SK, Nair  GB, Shimada  T, Emergence of a novel strain of Vibrio cholerae with epidemic potential in southern and eastern India. Lancet. 1993;341:703–4. DOIPubMedGoogle Scholar
  4. Nair  GB, Ramamurthy  T, Bhattacharya  SK, Mukhopadhyay  AK, Garg  S, Bhattacharya  MK, Spread of Vibrio cholerae O139 Bengal in India. J Infect Dis. 1994;169:1029–34.PubMedGoogle Scholar
  5. Nair  GB, Albert  MJ, Shimada  T, Takeda  Y. Vibrio cholerae O139 Bengal: the new serogroup causing cholera. Medical Microbiological Reviews. 1996;7:43–51.
  6. Sharma  C, Nair  GB, Mukhopadhyay  AK, Bhattacharya  SK, Ghosh  RK, Ghosh  A. Molecular characterization of V. cholerae O1 biotype El Tor strains isolated between 1992 and 1995 in Calcutta, India: evidence for the emergence of a new clone of the El Tor biotype. J Infect Dis. 1997;175:1134–41. DOIPubMedGoogle Scholar
  7. Mukhopadhyay  AK, Garg  S, Mitra  R, Basu  A, Dutta  D, Bhattacharya  SK, Temporal shifts in traits of Vibrio cholerae strains isolated from hospitalized patients in Calcutta: a 3-year (1993-1995) analysis. J Clin Microbiol. 1996;34:2537–43.PubMedGoogle Scholar
  8. Sharma  C, Maiti  S, Mukhopadhyay  AK, Basu  A, Basu  I, Nair  GB, Unique organization of the CTX genetic element in Vibrio cholerae O139 strains which reemerged in Calcutta, India, in September, 1996. J Clin Microbiol. 1997;35:3348–50.PubMedGoogle Scholar
  9. Kimsey  H, Nair  GB, Ghosh  A, Waldor  MK. Diverse CTX s and evolution of new pathogenic Vibrio cholerae. Lancet. 1998;353:457–8. DOIGoogle Scholar
  10. Mitra  R, Basu  A, Dutta  D, Nair  GB, Takeda  Y. Resurgence of Vibrio cholerae O139 Bengal with altered antibiogram in Calcutta, India. Lancet. 1996;348:1181. DOIPubMedGoogle Scholar
  11. Mukhopadhyay  AK, Basu  A, Garg  P, Bag  PK, Ghosh  A, Bhattacharya  SK, Molecular epidemiology of reemergent Vibrio cholerae O139 Bengal in India. J Clin Microbiol. 1998;36:2149–52.PubMedGoogle Scholar
  12. World Health Organization. Guidelines for cholera control. Geneva: The Organization; 1993.
  13. Yamamoto  T, Nair  GB, Parodi  CC, Takeda  Y. In vitro susceptibilities to antimicrobial agents of V. cholerae O1 and O139. Antimicrob Agents Chemother. 1993;39:241–4.
  14. Keasler  SP, Hall  RH. Detecting and biotyping V. cholerae O1 with multiplex polymerase chain reaction. Lancet. 1993;341:1661. DOIPubMedGoogle Scholar
  15. Colombo  MM, Mastrandrea  S, Santona  A, de Amdrade  AP, Uzzau  S, Rabino  S, Distribution of the ace, zot, and ctxA toxin genes in the clinical and environmental Vibrio cholerae. J Infect Dis. 1994;170:750–1.PubMedGoogle Scholar
  16. Basu  A, Mukhopadhyay  AK, Sharma  C, Jyot  J, Gupta  N, Ghosh  A, Heterogeneity in the organization of the CTX genetic element in strains of Vibrio cholerae O139 Bengal isolated from Calcutta, India and Dhaka, Bangladesh and its plausible link to the dissimilar incidence of O139 cholera in the two locales. Microb Pathog. 1998;24:175–83. DOIPubMedGoogle Scholar
  17. Yamasaki  S, Nair  GB, Bhattacharya  SK, Yamamoto  S, Kurazono  H, Takeda  Y. Cryptic appearance of a new clone of Vibrio cholerae O1 biotype El Tor in Calcutta, India. Microbiol Immunol. 1997;41:1–6.PubMedGoogle Scholar
  18. Waldor  MK, Mekalanos  JJ. Vibrio cholerae O139 specific gene sequence. Lancet. 1994;343:1366. DOIPubMedGoogle Scholar
  19. Kaper  JB, Morris  JG Jr, Nishibuchi  M. DNA probes for pathogenic Vibrio species. In: Tenover FC, editor. DNA probes for infectious disease. Boca Raton (FL): CRC Press, Inc.; 1992. p. 65-77.
  20. Murray  MG, Thompson  WF. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 1980;8:4321–5. DOIPubMedGoogle Scholar
  21. Pajni  S, Sharma  C, Bhasin  N, Ghosh  A, Ramamurthy  T, Nair  GB, Studies on the genesis of Vibrio cholerae O139: identification of probable progenitor strains. J Med Microbiol. 1994;42:20–5. DOIGoogle Scholar
  22. Bhadra  RK, Roychoudhury  S, Banerjee  RK, Kar  S, Majumdar  R, Sengupta  S, Cholera toxin (CTX) genetic element in Vibrio cholerae O139. Microbiology. 1995;141:1977–83. DOIPubMedGoogle Scholar
  23. Mekalanos  JJ. Duplication and amplification of cholera toxin genes in Vibrio cholerae. Cell. 1983;35:253–63. DOIPubMedGoogle Scholar
  24. Waldor  MK, Tschape  H, Mekalanos  JJ. A new type of conjugative transposon encodes resistance to sulfamethoxazole, trimethoprim and streptomycin in Vibrio cholerae O139. J Bacteriol. 1996;178:4157–65.PubMedGoogle Scholar
  25. Faruque  SM, Alim  ARMA, Rahman  MM, Siddique  AK, Sack  RB, Albert  MJ. Clonal relationships assay classical Vibrio cholerae O1 strains isolated between 1961 and 1992 in Bangladesh. J Clin Microbiol. 1993;31:2513–6.PubMedGoogle Scholar
  26. Faruque  SM, Ahmed  KM, Siddique  AK, Zoman  K, Alim  ARMA, Albert  MJ. Molecular analysis of toxigenic Vibrio cholerae in Bangladesh studied by numerical analysis of rRNA gene restriction patterns. J Clin Microbiol 1997;35.2299-306.
  27. Faruque  SM, Roy  SK, Alim  ARMA, Siddique  AK, Albert  MJ. Molecular epidemiology of toxigenic Vibrio cholerae in Bangladesh studied by numerical analysis of rRNA gene restriction patterns. J Clin Microbiol. 1995;33:2833–8.PubMedGoogle Scholar
  28. Faruque  SM, Ahmed  KM, Alim  ARMA, Qadri  F, Siddique  AK, Albert  MJ. Emergence of a new clone of toxigenic Vibrio cholerae O1 biotype El Tor displacing V. cholerae O139 Bengal in Bangladesh. J Clin Microbiol. 1997;35:624–30.PubMedGoogle Scholar
  29. Faruque  SM, Alim  ARMA, Roy  SK, Khan  F, Nair  GB, Sack  RB, Molecular analysis of rRNA and cholera toxin genes carried by the new epidemic strain of toxigenic Vibrio cholerae O139 synonym Bengal. J Clin Microbiol. 1994;33:1050–3.

Main Article

Page created: December 16, 2010
Page updated: December 16, 2010
Page reviewed: December 16, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external