Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 7, Number 3—June 2001

Correction

Correction: Vol. 6, No. 5

Cite This Article

In the article, “Prevalence of Non-O157:H7 Shiga Toxin-Producing Escherichia coli in Diarrheal Stool Samples from Nebraska,” by Paul D. Fey et al., an error occurred in reporting a primer used for amplifying the shiga-toxin gene.

The first complete sentence at the top of column 1, page 531, should read, “The following set of primers, which detects both stx1 and stx2, was used: 5' TTTACGATAGACTTCTCGAC 3' and 5' CACATATAAATTATTTCGCTC 3'.” We regret any confusion this error may have caused.

Top

Cite This Article

DOI: 10.3201/eid0703.c10703

Table of Contents – Volume 7, Number 3—June 2001

EID Search Options
presentation_01 Advanced Article Search – Search articles by author and/or keyword.
presentation_01 Articles by Country Search – Search articles by the topic country.
presentation_01 Article Type Search – Search articles by article type and issue.

Top

Page created: April 26, 2012
Page updated: April 26, 2012
Page reviewed: April 26, 2012
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external