Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 9, Number 11—November 2003

Dispatch

Fluoroquinolone Resistance Linked to GyrA, GyrB, and ParC Mutations in Salmonella enterica Typhimurium Isolates in Humans

Tables
Article Metrics
65
citations of this article
EID Journal Metrics on Scopus
Author affiliations: *Hôpital Saint-Louis, Université Paris VII, Paris, France; †INSERM E0004-LRMA, Université Paris VI, Paris, France; ‡Centre Hospitalier Villeneuve-Saint Georges, Villeneuve-Saint Georges, France; §Centre Hospitalier de Compiègne, Compiègne, France; ¶Hôpital du Val d’Yerres, Yerres, France

Cite This Article

Abstract

We report two cases of infection with clonally unrelated, high-level ciprofloxacin-resistant, β-lactamase–producing strains of Salmonella enterica Typhimurium. Resistance was caused by four topoisomerase mutations, in GyrA, GyrB, and ParC and increased drug efflux. Ciprofloxacin treatment failed in one case. In the second case, reduced susceptibility to third-generation cephalosporins occurred after initial treatment with these drugs and may explain the treatment failure with ceftriaxone.

Ciprofloxacin, a member of the large and widely used fluoroquinolone group of antimicrobial drugs, is considered the empirical treatment of choice of gastrointestinal infections in adults. The fluoroquinolones have been licensed for use in humans as well as in food-producing animals. This use has raised a worldwide debate on the selection of fluoroquinolone-resistant bacteria in, and the possible circulation between, the different ecosystems concerned (1). While resistance to these drugs occurred quickly in Escherichia coli and several other enterobacteriaceae, high-level resistance to ciprofloxacin (HLRC) has been found exceptionally in salmonellae (25). The low prevalence of salmonellae with HLRC has been ascribed to counter selection in the environment (6), an observation corroborated by the difficulty in selecting HLRC mutants in vitro. This type of resistance generally involves multiple mutations in the genes encoding the quinolone target enzymes, gyrase and topoisomerase IV (2), and mutations in regulatory systems (marORAB [7]) or soxRS [8]) or drug efflux systems (AcrAB) (9). We report two cases of infection caused by multiple-resistant Salmonella enterica Typhimurium with HLRC in which initial therapy failed and present data on the fluoroquinolone resistance mechanism.

The Study

Case 1

A 74-year-old man with an aorto-femoral bypass and chronic prostatitis became febrile and was treated empirically with ciprofloxacin. After 2 weeks of persistent fever, he was hospitalized. A pyelonephritis was diagnosed and endocarditis suspected. Urinalysis and blood culture both led to the isolation of a strain of S. Typhimurium (STmA) resistant to ciprofloxacin, amoxicillin, tetracycline, chloramphenicol, and sulfonamide. A treatment with cefotaxime was started, the fever subsided, and the patient recovered and was discharged. He did not go for follow-up consultations.

Case 2

A 3-month-old boy (body weight 6 kg) arrived at the hospital with severe diarrhea and fever. A stool culture indicated a strain of S. Typhimurium (STmB1) resistant to ciprofloxacin, amoxicillin, tetracycline, trimethoprime, chloramphenicol, streptomycin, spectinomycin, and gentamicin. Treatment was initiated with ceftriaxone IV (250 mg/day) and maintained for 7 days. Signs and symptoms improved for a few days, but fever relapsed after 2 weeks. A second stool culture indicated S. Typhimurium strain STmB2, with the resistance phenotype of the original isolate. A second treatment with the same antimicrobial drug IV (300 mg/day) was given for 6 days, again with apparent initial success. However, fever and diarrhea reoccurred after 3 weeks (isolation of strain STmB3 from stool sample). All symptoms disappeared after oral treatment with cefpodoxime (96 mg/day/7 days). The search for carriers within the family was positive in one, with isolation of strain STmC in a 1-year-old sibling who showed no clinical signs of infection.

All STm strains were analyzed for their lysotype, pulsed-field gel electrophoretic (PFGE) pattern, and resistance phenotype and genotype, as previously described (10). Strain STmA was phage nonsusceptible; all STmB and STmC strains were of lysotype 12. The last two had identical PFGE profiles after digestion of genomic DNA with XbaI, patterns that were clearly different from that of STmA (5 of 12 fragments were in common). Polymerase chain reaction (PCR) amplification indicated β-lactamase genes in these strains of type TEM in STmA and of type TEM and OXA-1 in the STmB and STmC strains. MICs of the antimicrobial drugs shown in the Table were determined for the five clinical strains and the reference strain S. Typhimurium NCTC 12416 (phage type LT2), on Mueller-Hinton medium containing serially twofold diluted antimicrobial drugs. MICs of ethidium bromide and of ciprofloxacin, cefotaxime, and ceftriaxone in the presence of the efflux pump inhibitor Phe-Arg-β-naphthylamide (Sigma-Aldrich Chimie, Saint Quentin Fallavier, France) (11) at concentrations of 50 mg/L were also determined. All clinical strains were similarly high-level resistant to fluoroquinolones. Isolate STmA, producing the TEM β-lactamase, was more susceptible to cefotaxime and ceftriaxone than the STmB and STmC isolates producing in addition OXA-1, and the post-treatment STm strains B2 and B3 were two- to fourfold less susceptible to the third-generation cephalosporins than STmB1 (Table). In the presence of Phe-Arg-β-naphthylamide at 50 mg/L, a concentration at which no inhibition of growth was observed in the controls, MICs of ciprofloxacin were reduced fourfold and those of cefotaxime and ceftriaxone were reduced twofold. All STm isolates showed strongly reduced susceptibility to ethidium bromide (MIC > 1,000 mg/L as opposed to <100 mg/L for the reference strain).

To identify mutations responsible for HLRC, the quinolone resistance determining regions (QRDR) of DNA gyrase and topoisomerase IV were determined after nucleotide sequencing of the corresponding QRDR fragments which were PCR-amplified with the respective pairs of primers: 5′CTGAAGCCGGTACACCGTCG and 5′TCGGCCATCAGTTCGTGGGC for gyrA; 5′TTATCGATGCTGCGCGTGCC and 5′TCGCCGCTTTCAGGGCGTTC for gyrB; 5′CGCCTACTTAAACTACTCCA and 5′ATCAGCGTAATCGCCGCTTT for parC; and 5′GACC-GAGCTGTTCCTTGTGG and 5′GCGTAACTGCATCGGGTTCA for parE. The QRDRs of the topoisomerases of the five strains had identical mutations in GyrA (Ser83Phe and Asp87Asn) and in GyrB (Ser464Phe), while distinct mutations were observed in ParC (Glu84Lys in strain STmA and Ser80Arg in all STmB and STmC strains). The recently described quinolone resistance-conferring gene qnr was absent from all STm strains as tested by PCR with the corresponding specific primers (12). Also, nucleotide sequencing did not show any mutation in the PCR-amplified marORA locus.

Electrophoretic (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) analysis of outer membrane proteins indicated the loss of one of them, possibly a porin (data not shown), in the post-treatment isolates STmB2 and STmB3. These changes did not influence the levels of fluoroquinolone resistance but were associated with reduced susceptibility to cefoxitin and cefotaxime (fourfold) and to ceftriaxone (twofold) (Table).

Conclusions

The two cases reported here show that clonally unrelated HLRC strains of S. Typhimurium, which may cause severe infections, are present in the community. In both cases initial treatment failed, respectively, with a fluoroquinolone and a third-generation cephalosporin. In the first case, the failure may be attributable to the multiple topoisomerase mutations (possibly in conjunction with increased drug efflux), although treatment failures have been reported in cases of lower levels of resistance to ciprofloxacin (13). In the second case, the reason for the initial treatment failure with ceftriaxone is less obvious. Strain STmB1 had the potential to decrease its susceptibility to third-generation cephalosporins under treatment, possibly related to the loss of an outer membrane protein. The high-level resistance to ethidium bromide and the increased susceptibility of the strains to ciprofloxacin in the presence of Phe-Arg-β-naphthylamide were strongly suggestive of an activated drug efflux system, such as AcrAB, the substrates of which also include cephalosporins with lipophilic side chains (2,14). The growth rates of the strains were the same as that of the reference strain, an observation which is at variance with that made with experimental fluoroquinolone-resistant mutants selected in animals (6) and which might imply the existence of additional compensatory mutants in the human STm isolates.

Low-level ciprofloxacin resistance in salmonellae has been observed occasionally in the environment in France (15) and elsewhere (16). Since we did not have a pretreatment isolate at our disposal, we are not certain whether any of the mutations resulting in the high-level fluoroquinolone resistance observed in strain STmA were selected under treatment. On the other hand, HLCR strain STmB may have been acquired as such from the environment or through the food chain, since neither the patient nor his sibling had ever been treated with fluoroquinolones, although no salmonellae with this phenotype have been observed to date from environmental or animal sources in France. In fact, to our knowledge, quadruple mutations affecting three topoisomerase subunits have never been reported before in salmonellae.

The unwelcome occurrence of fluoroquinolone-resistant salmonellae accumulating multiple mechanisms of resistance could compromise standard therapy of infections attributable to such pathogens. For children, an initial high-dose regimen with commonly used third-generation cephalosporins, or with oral cephalosporins, may therefore be indicated for the treatment of infections caused by S. Typhimurium strains such as STmB1.

Dr. Casin is a medical microbiologist at the Hôpital Saint-Louis, a University Teaching Hospital in Paris, France. She works on various aspects of bacterial resistance to antimicrobial drugs in gram-negative bacteria, including molecular epidemiology and mechanisms.

Top

Acknowledgments

We gratefully acknowledge F. Grimont and F.X. Weill for lysotype determinations.

This work was supported in part by a grant from the Ministère de la Recherche et de la Technologie (Programme de Recherche Fondamentale en Microbiologie et Maladies Infectieuses et Parasitaires).

Top

References

  1. Angulo  FJ, Johnson  KR, Tauxe  RV, Cohen  ML. Origins and consequences of antimicrobial-resistant non-typhoidal Salmonella: implications for the use of fluoroquinolones in food animals. Microb Drug Resist. 2000;6:7783. DOIPubMedGoogle Scholar
  2. Piddock  LJV. Fluoroquinolone resistance in Salmonella serovars isolated from humans and food animals. FEMS Microbiol Rev. 2002;26:316.PubMedGoogle Scholar
  3. Heisig  P, Kratz  B, Halle  E, Graser  Y, Altwegg  M, Rabsch  W, Identification of DNA gyrase A mutations in ciprofloxacin-resistant isolates of Salmonella typhimurium from men and cattle in Germany. Microb Drug Resist. 1995;1:2118. DOIPubMedGoogle Scholar
  4. Herikstad  H, Hayes  P, Mokhtar  M, Fracaro  ML, Threlfall  EJ, Angulo  FJ. Emerging quinolone-resistant Salmonella in the United States. Emerg Infect Dis. 1997;3:3712. DOIPubMedGoogle Scholar
  5. Nakaya  H, Yasuhara  A, Yoshimura  K, Oshihoi  Y, Izumiya  H, Watanabe  H. Life-threatening infantile diarrhea from fluoroquinolone-resistant Salmonella enterica Typhimurium with mutations in both gyrA and parC. Emerg Infect Dis. 2003;9:2557.PubMedGoogle Scholar
  6. Giraud  E, Brisabois  A, Martel  JL, Chaslus-Dancla  E. Comparative studies of mutations in animal isolates and experimental in vitro- and in vivo-selected mutants of Salmonella spp. suggest a counterselection of highly fluoroquinolone-resistant strains in the field. Antimicrob Agents Chemother. 1999;43:21317.PubMedGoogle Scholar
  7. Alekshun  MN, Levy  SB. Regulation of chromosomally mediated multiple antibiotic resistance: the mar regulon. Antimicrob Agents Chemother. 1997;41:206775.PubMedGoogle Scholar
  8. Koutsolioutsou  A, Martins  EA, White  DG, Levy  SB, Demple  B. A soxRS-constitutive mutation contributing to antibiotic resistance in a clinical isolate of Salmonella enterica (serovar typhimurium). Antimicrob Agents Chemother. 2001;45:3843. DOIPubMedGoogle Scholar
  9. Piddock  LJV, White  DG, Gensberg  K, Pumbwe  L, Griggs  DJ. Evidence of an efflux pump mediating multiple antibiotic resistance in Salmonella enterica serovar Typhimurium. Antimicrob Agents Chemother. 2000;44:311821. DOIPubMedGoogle Scholar
  10. Casin  I, Breuil  J, Brisabois  A, Moury  F, Grimont  F, Collatz  E. Multidrug-resistant human and animal Salmonella Typhimurium isolates in France belong predominantly to a DT104 clone with the chromosome- and integron-encoded b-lactamase PSE-1. J Infect Dis. 1999;179:117382. DOIPubMedGoogle Scholar
  11. Renau  TE, Leger  R, Flamme  EM, Sangalang  J, She  MW, Yen  R, Inhibitors of efflux pumps in Pseudomonas aeruginosa potentiate the activity of the fluoroquinolone antibacterial levofloxacin. J Med Chem. 1999;42:492831. DOIPubMedGoogle Scholar
  12. Tran  JH, Jacoby  GA. Mechanism of plasmid-mediated quinolone resistance. Proc Natl Acad Sci U S A. 2002;99:563842. DOIPubMedGoogle Scholar
  13. Aarestrup  FM, Wiuff  C, Molbak  K, Threlfall  EJ. Is it time to change fluoroquinolone breakpoints for Salmonella spp.? Antimicrob Agents Chemother. 2003;47:8279. DOIPubMedGoogle Scholar
  14. Nikaido  H, Basina  M, Nguyen  V, Rosenberg  EY. Multidrug pump AcrAB of Salmonella Typhimurium excretes only those b-lactam antibiotics containing lipophilic side chains. J Bacteriol. 1998;180:468692.PubMedGoogle Scholar
  15. Breuil  J, Brisabois  A, Casin  I, Armand-Lefèvre  L, Frémy  S, Collatz  E. Antibiotic resistance in salmonellae isolated from humans and animals in France: comparative data from 1994 and 1997. J Antimicrob Chemother. 2000;46:96571. DOIPubMedGoogle Scholar
  16. Threlfall  EJ, Ward  LR, Rowe  B. Resistance to ciprofloxacin in non-typhoidal salmonellas from humans in England and Wales. Clin Microbiol Infect. 1999;5:1304. DOIPubMedGoogle Scholar

Top

Table

Top

Cite This Article

DOI: 10.3201/eid0911.030317

Table of Contents – Volume 9, Number 11—November 2003

EID Search Options
presentation_01 Advanced Article Search – Search articles by author and/or keyword.
presentation_01 Articles by Country Search – Search articles by the topic country.
presentation_01 Article Type Search – Search articles by article type and issue.

Top

Comments

Please use the form below to submit correspondence to the authors or contact them at the following address:

Ekkehard Collatz, University Paris VI, INSERM E0004–LRMA, 15, rue de l'Ecole de Médecine, Paris Cedex 06 75270, France; fax: 33 1 43 25 68 12

Send To

10000 character(s) remaining.

Top

Page created: January 21, 2011
Page updated: January 21, 2011
Page reviewed: January 21, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external