Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 9, Number 5—May 2003

Research

Human Milk Secretory Antibodies against Attaching and Effacing Escherichia coli Antigens

Article Metrics
34
citations of this article
EID Journal Metrics on Scopus
Author affiliations: *University of Texas-Houston Medical School, Houston, Texas, USA; †Instituto Nacional de la Nutricion “Salvador Zubiran,” México City, México, D. F.; ‡Cincinnati Children’s Hospital, Cincinnati, Ohio, USA; §Center for Disease Control and Prevention, Atlanta, Georgia, USA; ¶GBF-German National Research Centre for Biotechnology, Braunschweig, Germany

Cite This Article

Abstract

Secretory immunoglobulin A (sIgA) is a primary factor responsible for preventing attachment of enteropathogens to gut epithelium in breastfeeding infants. We compared the frequency of sIgA to major surface antigens of enterohemorrhagic Escherichia coli (EHEC) in milk of 123 women from the United States and Mexico to determine whether regional differences existed in the frequency of antibodies to these surface antigens. In both groups of women, milk commonly has sIgA against various EHEC lipopolysaccharides, EspA, EspB, intimin, and less frequently against Shiga toxin. The study suggests that persons living in the U.S. are exposed to attaching/effacing enteropathogens more frequently than is generally assumed. The low frequency of antibodies to Stx1 (in 12% of Mexican and in 22% of U.S. samples) suggests that the rare appearance of hemolytic uremic syndrome in adults is not due to neutralization of toxin at the gut level. Only anti-EspA is found in most milk samples from both populations of women. EspA may represent a useful target for an immunization strategy to prevent EHEC disease in humans.

Enterohemorrhagic Escherichia coli (EHEC) produces multiple virulence factors; the most important are protein synthesis–inhibiting toxins: Shiga toxin 1 (Stx1) and 2 (Stx2). EHEC causes nonbloody diarrhea, hemorrhagic colitis, and hemolytic uremic syndrome (HUS). A large number of EHEC serotypes infect humans. In the United States, the predominant EHEC serotype associated with serious disease is E. coli O157:H7. HUS complicates approximately 5% to 8% of infections caused by E. coli O157:H7.

Virulence in EHEC reflects not only toxin production but also the pathogen’s ability to colonize the gut. Colonization by EHEC is related to the pathogen’s ability to form attaching and effacing lesions (intestinal mucosal changes seen in transmission electron microscopy and originally seen in intestines of animals infected with enteropathogenic E. coli [EPEC]) (1). The lesions are characterized by localized destruction of brush border microvilli and intimate adhesion of the bacterium to the host cell membrane. At the site of bacterial attachment, the host cell membrane forms a pedestal-like structure. Immunofluorescence microscopy has shown that the area of host cell in proximity to the bacterium contains polymerized actin, α-actinin, talin, and ezrin (2). In both EHEC and EPEC, the proteins that mediate this attachment are encoded in a chromosomal pathogenicity island called the “locus of enterocyte effacement” (LEE) (3). Secretion of LEE proteins is triggered by close contact with host cells. Once triggered to express LEE, the bacterium forms an export apparatus that includes a tube made of multimers of a protein (EspA); this surface organelle acts as a conduit between the bacteria and host cell (46). EspB, a protein thought to be involved in pore formation, is transferred to the host cell by this conduit and is found in both the host cell membrane and cytosol (7). EspB, with the aid of a second membrane lytic protein, EspD, forms pores in the host cell as part of the translocation mechanism (8). The EspA organelle is used to transfer the translocated intimin receptor (Tir), which is then inserted into the host cell membrane, where it binds to intimin, a bacterial outer membrane protein (9,10) and triggers the host cytoskeletal events that lead to attaching/effacing lesion formation.

Development of specific immunity to these antigens plays a role in protecting against infection. Immune responses are elicited in patients who are infected with EHEC or EPEC. Children infected with EPEC have been shown to have serum immunoglobulin (Ig) G against intimin, EspA, and EspB (11). Likewise, serum IgG against Tir, intimin, EspA, and EspB has been demonstrated during EHEC infection (1214). Specific IgG against O157 lipopolysacchartide (LPS) (15) and against EHEC intimin (16) blocks adherence in vitro.

Human milk is protective against many enteropathogens. Because antibodies in milk reflect previous immunologic events in the mother’s gut, human milk is ideally suited for defining mucosal protective immunity. Lymphocytes are known to travel from the gut to the mammary gland. Human milk contains antibodies to EHEC intimin, EspA, EspB, and Tir (1720), and to EPEC intimin (19). Incubation of colostrum or pooled human milk decreases EPEC adherence (2123). Hence, the protective effect seen in vitro has been attributed to the presence of these antibodies. The role of virulence antigen–specific sIgA in protecting against EHEC has not been assessed directly. For EHEC and EPEC, as for most enteric pathogens, the best hope for disease control is through a vaccine strategy. Candidates for an EHEC vaccine might, in theory, include the surface-exposed components, secreted components, or both.

Antibodies in human milk can be used as an epidemiologic tool because antibodies reflect previous infection in the mother (24). We compared milk samples of women from Mexico and from the United States for antibodies to LPS and virulence proteins involved in the initial bacteria-host cell interaction. We also evaluated milk samples for antibodies to Stx1, a major secreted virulence factor of EHEC. We compared the frequency and amount of antibodies to each of the antigens in these two populations to determine whether important differences in sIgA antibodies exist that might provide insight into exposure to these antigens and potential protective mechanisms.

Methods

Population and Milk Collection

Human milk samples were collected after informed consent from 123 women living in two widely separated areas of North America: Mexico City and Norfolk, Virginia. None of the women had premature infants. The study was approved by the Institutional Review Boards of each participating institution. None of the women were known to have an underlying illness. Whether they had previously experienced infections with attaching/effacing organisms was unknown. Milk samples were obtained by using an Ameda Egnell pump (Hollister, Inc., Libertyville, IL). Samples were stored at –70°C after collection. Human milk samples were thawed and centrifuged at 13,200 rpm three times to obtain a clear fraction.

Preparation of Antigens
E. coli LPS

E. coli O157:H7 LPS was extracted with phenol water by using the method described by Westphal and Jann (25). Other purified LPS (O26, O55, O111, O127, and O128) were obtained from Sigma (Aldrich Corp., St. Louis, MO).

Stx

Stx1 was purified from Shigella dysenteriae serotype 1 as previously described (26). We evaluated antibodies to Stx1 rather than to Stx2 because approximately 90% of EHEC produce Stx1. Stx2 appears to be less immunogenic than is Stx1.

EspA and EspB

E. coli M15 with the plasmids encoding either C terminal histidine-tagged EspA or histidine-tagged EspB cloned from EHEC E. coli O26:H- strain 413/89-1 (6) was grown in Terrific broth (ENE Mate, ISC Bioexpress; Kaysville, UT) until optical density (OD) at A600 was 0.7. Bacteria were induced by adding isopropyl-β-D-thiogalactopyranoside (IPTG) to a final concentration of 1 mM at 30°C for 3 h. For purifying EspB, phenylmethylsulfonyl fluoride (1 mM) was added to the culture media. The cells were harvested by centrifugation. The resulting pellet was lysed through the addition of lysozyme and sonication. The resulting supernatant was mixed with nickel nitriloacetic agarose (Qiagen, Inc., Valencia, CA) for 1 h at 4°C. The agarose was then poured into a column and washed with increasing concentrations of imidazole in phosphate buffer (10 mM) to elute the purified proteins. All steps during the purification were performed under nondenaturing conditions following manufacturer’s instructions. Sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) was performed to confirm purity of eluted proteins.

Intimin Gamma

The 281 amino acid C terminal (extracellular) portion of intimin (C281γ) was cloned from E. coli O157:H7 strain 86-24 by using as forward primer 5-GATC- AAACCAAGGCCAGCATTACTGAGATT and reverse primer 5-AATAATTATGCCC- CGACTAAAACA. The taq polymerase amplified segment was inserted into polymerase chain reaction T7 NT-TOPO so that six histidine residues were added to the N terminus. The sequence was verified by digestion with EcoRI and BamHI and automated sequencing by using dye-terminator chemistry (BigDye as the fluorescent marker) in an ABI PRISM model 377 Genetic Analyzer (Applied Biosystems, Foster City, CA. The plasmid was then inserted into BL21(DE3)pLysS and expression inducted with IPTG. After partial purification with nickel nitriloacetic agarose chromatography, the amplified protein was detected on immunoblots (as described below). The C281γ was located on SDS-PAGE by size, intensity of the band after IPTC induction, and confirmation that the band contained 6 x His by Western blot.

Specific sIgA Determination by Enzyme-Linked Immunosorbent assay (ELISA)

ELISA was used to determine the presence and amount of sIgA against Stx1, EspA, EspB, and each LPS. The amount of sIgA was estimated based on the mean of duplicate measures of OD of the antigen-coated wells minus the control background wells. For each ELISA all samples were run on the same day to eliminate day-to-day variation. For EspA, EspB, and each of the LPS, 96-well polystyrene plates were coated overnight at 4°C with 1 μg/well of each antigen in carbonate buffer (pH 9.6). After coating, plates were blocked with 200 μL of 5% bovine serum albumin (BSA) in 10 mM sodium phosphate-buffered saline (PBS) for 1 h at 37°C. After each step, plates were washed five times with PBS containing 0.05% Tween 80. Human milk samples diluted 1:20 in 1% nonfat dry milk in PBS were incubated at 37°C for 1 h. Goat anti-human sIgA conjugated to horseradish peroxidase (Cappel Division of Organon Teknika, Durham, NC) was added after washing. Hydrogen peroxide with o-phenylenediamine dihydrochloride was used for color development. The reaction was stopped by adding 2 N sulfuric acid, and plates were read at 490 nm. For Stx1, we used a variation of a previously described receptor binding ELISA (27). Polyvinyl chloride plates were coated with Gb3, blocked with 5% BSA-PBS, washed five times with PBS-Tween, and coated with 1 μg/well of toxin overnight at 4°C. The plates were washed five times with PBS-Tween and blocked with 5% BSA-PBS before 100 μL of milk sample per well diluted 1:20 with 1% nonfat dry milk in PBS was applied. Goat anti-human sIgA conjugated to horseradish peroxidase was added after washing and OD determined as above.

SDS-PAGE and Western Blot Analysis

SDS-PAGE was performed on the protein samples diluted in sample buffer (2-mercapthoethanol, SDS, and 0.1% bromophenol blue), boiled for 5 min, and loaded into 12.5% gels. The protein bands were visualized by staining with Coomassie blue. After SDS-PAGE, unstained protein antigens or LPS were transferred electrophoretically onto nitrocellulose membranes and blocked with 3% nonfat dry milk in Tris buffer for 1 h. The membranes were incubated overnight with the human milk samples diluted 1:20 with 1% nonfat dry milk in Tris buffer at 4°C. After three washes, the bound sIgA was detected by using peroxidase conjugates as above with chloro-1-naphthol as the color reagent. Western blot was used to determine the ELISA sensitivity and specificity as well as to detect sIgA to C281γ.

Statistical Analysis

Chi-square or Fisher exact test was used to compare the frequency of sIgA-positive milk samples in the two populations for each antigen. Since anti-C281γ antibody was detected by immunoblot rather than ELISA, its relationship to other antibodies was determined by chi-square test or Fishers exact test. For other antibodies that were measured quantitatively, differences between the populations in amounts of antibodies were determined by a two-tailed Mann-Whitney test. The correlation between the amount of sIgA for different antigens was determined by linear regression of ELISA ODs. Because of the multiple comparisons made, differences were considered significant at p<0.01.

Results

Description of Populations

Milk samples from 73 women in Mexico City and 50 women in Norfolk, Virginia, were studied. No difference existed in the timing of collection of the milk samples between the two populations (Table 1).

Validation of Assays

Purification of histidine-tagged EspA and EspB resulted in a single band of protein in the eluate as visualized by SDS-PAGE. As expected, ELISAs were highly reproducible. For example, the correlation between OD490 on repeat assays of randomly chosen samples for antibody to O111 was 0.858 (p<0.001), and for antibody to O26, the correlation was 0.807 (p<0.001). Based on the Western blot studies, the cutoff for a positive ELISA for each antigen was considered to be an OD>0.1 at 490 nm. The sensitivity and specificity of the ELISA for various antigens were high as determined by using Western blot as the standard. For example, sensitivity and specificity were 82% and 71% for O157 LPS, 100% and 88% for EspB, and 93% and 100% for EspA, respectively. Because of the inherent differences in sensitivity of immunoblots compared to enzyme immunoassays on plastic plates, by using Western blot as the standard for defining ELISA cutoff, we may have underestimated somewhat the frequency of milk samples that contain sIgA to some antigens.

Prevalence of Antibodies to EHEC Antigens

Large variations occurred in frequencies of milk samples containing antibody to the various LPS. The percentages of milk samples that contained antibodies to various LPS types were similar in the two populations, with the exception of anti-O128, which occurred significantly more often in milk samples from women from the United States (Table 2). However, the amount of antibody to the various LPSs differed significantly in the two settings. Mexican women had higher levels of antibodies (Table 3) against O55 and O127; they also had higher antibody levels against EspA and EspB. Milk samples from U.S. women had higher levels of antibodies against O26, O111, O128, and Shiga toxin.

Relationship of sIgA Antibodies to LSP, Intimin Gamma, EspA, EspB, and Shiga Toxin

Women in both populations who had antibodies to EspB nearly always had antibodies to EspA in their milk; 98% of those whose milk samples were positive for anti-EspB antibodies were also positive for anti-EspA antibodies, whereas those who were positive for anti-EspA were positive for anti-EspB 43% of the time (p<0.01 by chi square). Although anti-EspB was found less often than anti-EspA, the amount of anti-EspB correlated with the amount of anti-EspA in both populations (Tables 4 and 5). The amount of anti-EspA antibodies also was correlated with anti-O55 in milk samples from Mexico and with anti-O55 and anti-O127 milk samples from the United States. The data regarding antibodies to antigens that are EHEC-specific suggested that O55 and O111, but not O157, are important EHEC serotypes in Mexico (Table 4) since anti-Stx1 correlated well with antibodies to these LPS types. These findings are consistent with studies of meat samples in Mexico, which suggest that O157 is rarely found (28). Anti-C281 γ correlated with anti-Stx1 and anti-O55 in Mexican women but not in U.S. women (Table 6). Most milk samples (17 [85%] of 20) positive for anti-C281γ were from Mexican women with antibody to O55 LPS (p=0.0001). These relationships imply that Shiga toxin and intimin gamma antibodies were linked to E. coli O55 infection. In the milk samples from U.S. women, anti-Stx did not correlate with any LPS type including O157 (Table 5).

Discussion

The specific antibodies that may be important in sIgA-mediated passive immune protection and infection-induced active immunity in human milk are not known. Milk, because it contains the infection-triggered active mucosal immune response of the mother, reflects antibodies that are relevant to clearing her particular infection and to subsequently protecting her infant. As such, milk antibodies indicate to which antigens the immune system has been most responsive. Focusing on such antigens may suggest candidates for vaccine development.

In EPEC, formation of the attaching/effacing lesion is central to pathogenesis. Colostrum, and in particular, the sIgA fraction, has been shown previously to inhibit localized adherence of EPEC (21,22). Epidemiologic data also support the importance of attaching/effacing lesion formation in the pathogenesis of EHEC. The eaeA gene is more commonly found in human isolates than bovine EHEC isolates (29,30) and in isolates known to have caused severe human diseases (31), suggesting that proteins found in LEE are important virulence factors.

Previous studies of anti-attaching/effacing antibodies in human milk (17,19,22,32) have reported data on small numbers of milk samples, sometimes by using only pooled colostrum or by using crude antigens. The methodologic differences between previous studies and the current data are important to interpretating the data. The most comparable previous study in the literature is that of Parissi-Crivelli et al. (19). They found antibodies in the colostrum of 21 Mexican women against EspB in 57%, EspA in 76%, and intimin in 81%, compared with our findings of 44%, 93%, and 27%, respectively. The differences are important because the earlier data suggest that intimin is recognized much more frequently than our results show. Routine recognition of intimin would suggest that mucosal immunity that occurs naturally during infection targets this antigen. As such, intimin might be a useful antigen for a potential vaccine development plan. However, the difference between the studies may have occurred because we determined antibodies only to the extracellular C terminal 281-amino acid portion of intimin gamma that defines tissue tropism (33) rather than to the whole molecule. Antibodies to the intracellular portion of intimin were not detected by using our approach. That antibodies to the intracellular portion of intimin are relevant to protection is biologically implausible. In fact, antibodies to the N terminal two-thirds of the intimin molecule do not prevent EHEC from attaching to HEp2 cells (16). We have therefore focused on antibodies to the receptor-binding domain (34) that could be relevant to protection in the gut. This approach makes our observations more pertinent to intimin gamma-positive EHEC than to organisms that express other intimin variants.

This study supports the previous suggestion that human milk can be used as an epidemiologic tool (24). Because lymphocytes travel from the gut to mammary glands by the common mucosal immune system, sIgA in human milk reflects previous intestinal infection. Many insights into antigen-specific sIgA, the most relevant antibody to protection from intestinal infection, can be gained by studying human milk. For example, our data show regional variations in exposure to E. coli LPS types in two study sites. Exposure to multiple LPS types, including O55 and O111, correlates with anti-EspA in the United States, while in Mexico only O55 occurs commonly enough for anti-EspA to correlate with anti-LPS. The lack of correlation between the presence of antibodies against Stx1 and O157 LPS in the United States suggests that mucosal immunity to the toxin is not related to previous exposure to O157 EHEC. In Mexico, the primary stimulus for development of antibody to Stx1 may be becoming infected with O55 or O111 EHEC rather than with O157 EHEC. That these serogroups are infrequently associated with HUS suggests that they may be less virulent, less easily diagnosed, or less likely to cause outbreaks of disease than E. coli O157:H7. The lack of readily available screening methods for EHEC serotypes other than O157 may cause the frequency of non-O157 types to be underestimated. The surprisingly low frequency of sIgA against Shiga toxin suggests that mucosal immunity to the toxin is not the basis for the low frequency of HUS in adults; antibodies with expressed virulence factors that block attachment are probably more important.

We thought that milk samples from the U.S. women would rarely show evidence of immunity to antigens expressed by EPEC or EHEC. In fact, the data suggest that exposure to organisms that produce attaching/effacing lesions must be much more common than anticipated. Antibodies to surface antigens of EHEC, particularly those involved in the initial interaction of bacteria with intestinal epithelial cells, frequently are found in human milk. The data suggest that most women have been exposed to bacteria-expressing proteins that mediate the attaching/effacing phenotype, whether these women live in Mexico City or Norfolk, Virginia. Stool survey data also suggest that these infections may be occurring more often than commonly assumed. Bokete et al. analyzed stools from 445 children in the United States and found that 5.6% shed non-O157:H7 eaeA+ E. coli (35). A multicenter prevalence study on the cause of outpatient pediatric nondysenteric diarrhea in the United States showed that 2.7% had E. coli with localized adherence phenotype or with a positive probe for EPEC (36). Most U.S. laboratories do not routinely evaluate pediatric diarrheal stools for the presence of EPEC or EHEC. The sIgA antibody data shown here, coupled with the stool survey data, suggest that organisms producing the attaching/effacing lesion must be common pathogens in the United States. The similarity between frequencies of antibodies to important surface antigens suggests that the prevalence of HUS in industrialized countries as opposed to developing countries (37) is not due solely to differences in frequency of exposure to EPEC.

Our studied showed that EspA was found in most milk samples (>90%), while Parissi-Crivelli found a much lower frequency (19). The difference may exist because of their definition of a positive ELISA for EspA; they arbitrarily set an OD >0.2 as positive, while we established a cutoff by immunoblot. The difference could also reflect the antigens used for ELISA. We used purified EspA, which was confirmed by SDS-PAGE to be a single band with no detectable contaminants, while Parissi-Crivelli used sonicates of organisms expressing an unknown amount of EspA on a plasmid and subtracted as background the sonicates of the vector bacteria lacking the gene for EspA. We studied titers at a 1:20 dilution. Although the relatively low titers detected could reflect exposure to related antigens produced by other bacteria, the immunoblots demonstrated that the antibodies did react with the specific antigens.

Why the immune system recognizes one antigen more often than another when both are expressed during infection is not clear. However, given current understanding of the virulence mechanism involved in producing attaching/effacing lesions, the secretory IgA data are readily understandable. The lower frequency of antibodies to EspB than to anti-EspA reflects that the immune system has better recognition of the multimeric surface-exposed EspA organelle. EspB, a protein that is directly injected into the cytoplasmic membrane of intestinal epithelial cells through the EspA organelle, is likely to be less available for uptake by antigen-presenting cells.

In summary, antibodies against LEE-encoded proteins were common in samples of human milk from our two groups. Because of the structural similarity among EspA variants from multiple pathogens and the high frequency of anti-EspA antibodies, cross-reactive antibodies against EspA may provide broad cross-protection against multiple serotypes. EspA is more conserved than other virulence antigens; most clone 1 EPEC have identical EspA types, while most clone 2 are nearly 95% identical (38). EspA in E. coli O127:H6 and E. coli O157:H7 are 85% identical (39) EspA is surface expressed and multimeric. Antibody to EspA is present more often than is antibody to other surface proteins. Natural exposure to EspA appears to elicit a good immune response that is long lasting as reflected by the high percentage of women who have anti-EspA in their milk samples. Unlike antibodies to LPS or intimin (40) that may protect against a very limited group of enteropathogens, antibodies to EspA might be able to block attachment by both EPEC and EHEC of many serogroups and thereby provide broad cross-protection. EspA may be a useful candidate for an immunization strategy that could lead to a vaccine that protects against both EHEC and EPEC of multiple serotypes.

Dr. Noguera-Obenza is a pediatric infectious disease fellow at the University of Texas–Houston Health Science Center in Houston Texas. Her research interest is pathogenesis and immunity of enteropathogenic and enterohemorrhagic Escherichia coli.

Top

Acknowledgment

This work was supported by a grant from the National Institute of Health, NICHD PO1-HD13021-25.

Top

References

  1. Moon  HW, Whipp  SC, Argenzio  RA, Levine  MM, Giannella  RA. Attaching and effacing activities of rabbit and human enteropathogenic Escherichia coli in pig and rabbit intestines. Infect Immun. 1983;41:134051.PubMedGoogle Scholar
  2. Knutton  S, Baldwin  T, Williams  PH, McNeish  AS. Actin accumulation at sites of bacterial adhesion to tissue culture cells: basis of a new diagnostic test for enteropathogenic and enterohemorrhagic Escherichia coli. Infect Immun. 1989;57:12908.PubMedGoogle Scholar
  3. Frankel  G, Phillips  AD, Rosenshine  I, Dougan  G, Kaper  JB, Knutton  S. Enteropathogenic and enterohaemorrhagic Escherichia coli: more subversive elements. Mol Microbiol. 1998;30:91121. DOIPubMedGoogle Scholar
  4. Knutton  S, Rosenshine  I, Pallen  MJ, Nisan  I, Neves  BC, Bain  C, A novel EspA-associated surface organelle of enteropathogenic Escherichia coli involved in protein translocation into epithelial cells. EMBO J. 1998;17:216676. DOIPubMedGoogle Scholar
  5. Kenny  B, Lai  LC, Finlay  BB, Donnenberg  MS. EspA, a protein secreted by enteropathogenic Escherichia coli, is required to induce signals in epithelial cells. Mol Microbiol. 1996;20:31323. DOIPubMedGoogle Scholar
  6. Ebel  F, Podzadel  T, Rohde  M, Kresse  AU, Kramer  S, Deibel  C, Initial binding of Shiga toxin-producing Escherichia coli to host cells and subsequent induction of actin rearrangements depend on filamentous EspA-containing surface appendages. Mol Microbiol. 1998;30:14761. DOIPubMedGoogle Scholar
  7. Taylor  KA, O’Connell  CB, Luther  PW, Donnenberg  MS. The EspB protein of enteropathogenic Escherichia coli is targeted to the cytoplasm of infected HeLa cells. Infect Immun. 1998;66:55017.PubMedGoogle Scholar
  8. Kresse  AU, Rohde  M, Guzman  CA. The EspD protein of enterohemorrhagic Escherichia coli is required for the formation of bacterial surface appendages and is incorporated in the cytoplasmic membranes of target cells. Infect Immun. 1999;67:483442.PubMedGoogle Scholar
  9. DeVinney  R, Stein  M, Reinscheid  D, Abe  A, Ruschkowski  S, Finlay  BB. Enterohemorrhagic Escherichia coli O157:H7 produces Tir, which is translocated to the host cell membrane but is not tyrosine phosphorylated. Infect Immun. 1999;67:238998.PubMedGoogle Scholar
  10. Kenny  B, DeVinney  R, Stein  M, Reinscheid  DJ, Frey  EA, Finlay  BB. Enteropathogenic E. coli (EPEC) transfers its receptor for intimate adherence into mammalian cells. Cell. 1997;91:51120. DOIPubMedGoogle Scholar
  11. Martinez  MB, Taddei  CR, Ruiz-Tagle  A, Trabulsi  LR, Giron  JA. Antibody response of children with enteropathogenic Escherichia coli infection to the bundle-forming pilus and locus of enterocyte effacement-encoded virulence determinants. J Infect Dis. 1999;179:26974. DOIPubMedGoogle Scholar
  12. Paton  AW, Manning  PA, Woodrow  MC, Paton  JC. Translocated intimin receptors (Tir) of Shiga-toxigenic Escherichia coli isolates belonging to serogroups O26, O111, and O157 react with sera from patients with hemolytic-uremic syndrome and show marked sequence heterogeneity. Infect Immun. 1998;66:55806.PubMedGoogle Scholar
  13. Li  Y, Frey  E, Mackenzie  AM, Finlay  BB. Human response to Escherichia coli O157:H7 infection: antibodies to secreted virulence factors. Infect Immun. 2000;68:50905. DOIPubMedGoogle Scholar
  14. Jenkins  C, Chart  H, Smith  HR, Hartland  EL, Batchelor  M, Delahay  RM, Antibody response of patients infected with verocytotoxin-producing Escherichia coli to protein antigens encoded on the LEE locus. J Med Microbiol. 2000;49:97101.PubMedGoogle Scholar
  15. Paton  AW, Voss  E, Manning  PA, Paton  JC. Antibodies to lipopolysaccharide block adherence of Shiga toxin-producing Escherichia coli to human intestinal epithelial (Henle 407) cells. Microb Pathog. 1998;24:5763. DOIPubMedGoogle Scholar
  16. Gansheroff  LJ, Wachtel  MR, O’Brien  AD. Decreased adherence of enterohemorrhagic Escherichia coli to HEp-2 cells in the presence of antibodies that recognize the C-terminal region of intimin. Infect Immun. 1999;67:640917.PubMedGoogle Scholar
  17. Loureiro  I, Frankel  G, Adu-Bobie  J, Dougan  G, Trabulsi  LR, Carneiro-Sampaio  MM. Human colostrum contains IgA antibodies reactive to enteropathogenic Escherichia coli virulence-associated proteins: intimin, BfpA, EspA, and EspB. J Pediatr Gastroenterol Nutr. 1998;27:16671. DOIPubMedGoogle Scholar
  18. Manjarrez-Hernandez  HA, Gavilanes-Parra  S, Chavez-Berrocal  E, Navarro-Ocana  A, Cravioto  A. Antigen detection in enteropathogenic Escherichia coli using secretory immunoglobulin A antibodies isolated from human breast milk. Infect Immun. 2000;68:50306. DOIPubMedGoogle Scholar
  19. Parissi-Crivelli  A, Parissi-Crivelli  JM, Giron  JA. Recognition of enteropathogenic Escherichia coli virulence determinants by human colostrum and serum antibodies. J Clin Microbiol. 2000;38:2696700.PubMedGoogle Scholar
  20. Sanches  MI, Keller  R, Hartland  EL, Figueiredo  DM, Batchelor  M, Martinez  MB, Human colostrum and serum contain antibodies reactive to the intimin-binding region of the enteropathogenic Escherichia coli translocated intimin receptor. J Pediatr Gastroenterol Nutr. 2000;30:737. DOIPubMedGoogle Scholar
  21. Camara  LM, Carbonare  SB, Silva  ML, Carneiro-Sampaio  MM. Inhibition of enteropathogenic Escherichia coli (EPEC) adhesion to HeLa cells by human colostrum: detection of specific sIgA related to EPEC outer-membrane proteins. Int Arch Allergy Immunol. 1994;103:30710. DOIPubMedGoogle Scholar
  22. Cravioto  A, Tello  A, Villafan  H, Ruiz  J, del Vedovo  S, Neeser  JR. Inhibition of localized adhesion of enteropathogenic Escherichia coli to HEp-2 cells by immunoglobulin and oligosaccharide fractions of human colostrum and breast milk. J Infect Dis. 1991;163:124755.PubMedGoogle Scholar
  23. Delneri  MT, Carbonare  SB, Silva  ML, Palmeira  P, Carneiro-Sampaio  MM. Inhibition of enteropathogenic Escherichia coli adhesion to HEp-2 cells by colostrum and milk from mothers delivering low-birth-weight neonates. Eur J Pediatr. 1997;156:4938. DOIPubMedGoogle Scholar
  24. Nathavitharana  KA, Catty  D, McNeish  AS. IgA antibodies in human milk: epidemiological markers of previous infections? Arch Dis Child Fetal Neonatal Ed. 1994;71:F1927. DOIPubMedGoogle Scholar
  25. Westphal  O, Jann  K. Bacterial lipopolysaccharides: extraction with phenol-water and further applications of the procedure. Methods in Carbohydrate Chemistry. 1965;5:8391.
  26. Prado  D, Cleary  TG, Pickering  LK, Ericsson  CD, Bartlett  AV III, DuPont  HL, The relation between production of cytotoxin and clinical features in shigellosis. J Infect Dis. 1986;154:14955.PubMedGoogle Scholar
  27. Ashkenazi  S, Cleary  TG. Rapid method to detect shiga toxin and shiga-like toxin I based on binding to globotriosyl ceramide (Gb3), their natural receptor. J Clin Microbiol. 1989;27:114550.PubMedGoogle Scholar
  28. Heredia  N, Garcia  S, Rojas  G, Salazar  L. Microbiological condition of ground meat retailed in Monterrey, Mexico. J Food Prot. 2001;64:124951.PubMedGoogle Scholar
  29. Zschock  M, Hamann  HP, Kloppert  B, Wolter  W. Shiga-toxin-producing Escherichia coli in feces of healthy dairy cows, sheep and goats: prevalence and virulence properties. Lett Appl Microbiol. 2000;31:2038. DOIPubMedGoogle Scholar
  30. Orden  JA, Ruiz-Santa-Quiteria  JA, Cid  D, Garcia  S, Sanz  R, de la Fuente  R. Verotoxin-producing Escherichia coli (VTEC) and eae-positive non-VTEC in 1-30-days-old diarrheic dairy calves. Vet Microbiol. 1998;63:23948. DOIPubMedGoogle Scholar
  31. Boerlin  P, McEwen  SA, Boerlin-Petzold  F, Wilson  JB, Johnson  RP, Gyles  CL. Associations between virulence factors of Shiga toxin-producing Escherichia coli and disease in humans. J Clin Microbiol. 1999;37:497503.PubMedGoogle Scholar
  32. Costa-Carvalho  BT, Bertipaglia  A, Sole  D, Naspitz  CK, Scaletsky  IC. Detection of immunoglobulin (IgG and IgA) anti-outer-membrane proteins of enteropathogenic Escherichia coli (EPEC) in saliva, colostrum, breast milk, serum, cord blood and amniotic fluid. Study of inhibition of localized adherence of EPEC to HeLa cells. Acta Paediatr. 1994;83:8703. DOIPubMedGoogle Scholar
  33. Reece  S, Simmons  CP, Fitzhenry  RJ, Matthews  S, Phillips  AD, Dougan  G, Site-directed mutagenesis of intimin alpha modulates intimin-mediated tissue tropism and host specificity. Mol Microbiol. 2001;40:8698. DOIPubMedGoogle Scholar
  34. Frankel  G, Candy  DC, Fabiani  E, Adu-Bobie  J, Gil  S, Novakova  M, Molecular characterization of a carboxy-terminal eukaryotic-cell- binding domain of intimin from enteropathogenic Escherichia coli. Infect Immun. 1995;63:43238.PubMedGoogle Scholar
  35. Bokete  TN, Whittam  TS, Wilson  RA, Clausen  CR, O’Callahan  CM, Moseley  SL, Genetic and phenotypic analysis of Escherichia coli with enteropathogenic characteristics isolated from Seattle children. J Infect Dis. 1997;175:13829. DOIPubMedGoogle Scholar
  36. Caeiro  JP, Mathewson  JJ, Smith  MA, Jiang  ZD, Kaplan  MA, Dupont  HL. Etiology of outpatient pediatric nondysenteric diarrhea: a multicenter study in the United States. Pediatr Infect Dis J. 1999;18:947. DOIPubMedGoogle Scholar
  37. Nataro  JP, Kaper  JB. Diarrheagenic Escherichia coli. Clin Microbiol Rev. 1998;11:142201.PubMedGoogle Scholar
  38. Neves  BC, Knutton  S, Trabulsi  LR, Sperandio  V, Kaper  JB, Dougan  G, Molecular and ultrastructural characterisation of EspA from different enteropathogenic Escherichia coli serotypes. FEMS Microbiol Lett. 1998;169:7380. DOIPubMedGoogle Scholar
  39. Perna  NT, Mayhew  GF, Posfai  G, Elliott  S, Donnenberg  MS, Kaper  JB, Molecular evolution of a pathogenicity island from enterohemorrhagic Escherichia coli O157:H7. Infect Immun. 1998;66:38107.PubMedGoogle Scholar
  40. Ghaem-Maghami  M, Simmons  CP, Daniell  S, Pizza  M, Lewis  D, Frankel  G, Intimin-specific immune responses prevent bacterial colonization by the attaching-effacing pathogen Citrobacter rodentium. Infect Immun. 2001;69:5597605. DOIPubMedGoogle Scholar

Top

Tables

Top

Cite This Article

DOI: 10.3201/eid0905.020441

Table of Contents – Volume 9, Number 5—May 2003

EID Search Options
presentation_01 Advanced Article Search – Search articles by author and/or keyword.
presentation_01 Articles by Country Search – Search articles by the topic country.
presentation_01 Article Type Search – Search articles by article type and issue.

Top

Comments

Please use the form below to submit correspondence to the authors or contact them at the following address:

Thomas G. Cleary, University of Texas Medical School in Houston Department of Pediatrics, Pediatric Infectious Diseases Division, 6431 Fannin, JFB 1.739 Houston, TX 77040, USA; fax: 713-500-5688

Send To

10000 character(s) remaining.

Top

Page created: December 08, 2010
Page updated: December 08, 2010
Page reviewed: December 08, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external