Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 11, Number 1—January 2005
Research

Mycobacterium haemophilum and Lymphadenitis in Children

Lesla E.S. Bruijnesteijn van Coppenraet*, Edward J. Kuijper*Comments to Author , Jerome A. Lindeboom†, Jan M. Prins†, and Eric C. J. Claas*
Author affiliations: *Leiden University Medical Center, Leiden, the Netherlands; †Academic Medical Centre, Amsterdam, the Netherlands

Main Article

Table 1

Sequences of oligonucleotides used in this study

Primer/probe sequence (5′–3′) target sequence
ITS forward primer real-time PCR GGGGTGTGGTGTTTGAG Partial ITS
ITS reverse primer real-time PCR CTCCCACGTCCTTCATC Partial ITS
Forward primer Ec16S.1390p* TTGTACACACCGCCCGTCA Total ITS
Reverse primer Mb23S.44n* TCTCGATGCCAAGGCATCCACC Total ITS
16S forward primer P1† TAACACATGCAAGTCGAACG 16S
16S reverse primer P4† TCGTTGCGGGACTTAACCCAAC 16S
Mycobacterium genus–specific TaqMan probe Fam-GGATAGTGGTTGCGAGCATC-Tamra ITS
M. haemophilum–specific MGB-probe VIC–ACGCCACCATTACT-MGB ITS

*Primers published in (19).
†Primers published in (23).

Main Article

References
  1. American Thoracic Society. Diagnosis and treatment of disease caused by nontuberculous mycobacteria. Am J Respir Crit Care Med. 1997;156(Suppl):S1–25.PubMedGoogle Scholar
  2. Dawson  DJ, Blacklock  ZM, Kane  DW. Mycobacterium haemophilum causing lymphadenitis in an otherwise healthy child. Med J Aust. 1981;2:289–90.PubMedGoogle Scholar
  3. Thibert  L, Lebel  F, Martineau  B. Two cases of Mycobacterium haemophilum infection in Canada. J Clin Microbiol. 1990;28:621–3.PubMedGoogle Scholar
  4. Armstrong  KL, James  RW, Dawson  DJ, Francis  PW, Masters  B. Mycobacterium haemophilum causing perihilar or cervical lymphadenitis in healthy children. J Pediatr. 1992;121:202–5. DOIPubMedGoogle Scholar
  5. Haimi-Cohen  Y, Zeharia  A, Mimouni  M, Soukhman  M, Amir  J. Skin indurations in response to tuberculin testing in patients with nontuberculous mycobacterial lymphadenitis. Clin Infect Dis. 2001;33:1786–8. DOIPubMedGoogle Scholar
  6. Saubolle  MA, Kiehn  TE, White  MH, Rudinsky  MF, Armstrong  D. Mycobacterium haemophilum: microbiology and expanding clinical and geographic spectra of disease in humans. Clin Microbiol Rev. 1996;9:435–47.PubMedGoogle Scholar
  7. van de Griendt  EJ, Rietra  PJ, van Andel  RN. Mycobacterium haemophilum as the cause of lymphadenitis in the neck in an otherwise healthy boy. Ned Tijdschr Geneeskd. 2003;147:1367–9.PubMedGoogle Scholar
  8. Bruijnesteijn van Coppenraet  ES, Lindeboom  JA, Prins  JM, Peeters  MF, Claas  ECJ, Kuijper  EJ. Real-time PCR assay using fine-needle aspirates and tissue biopsy specimens for rapid diagnosis of mycobacterial lymphadenitis in children. J Clin Microbiol. 2004;42:2644–50. DOIPubMedGoogle Scholar
  9. Samra  Z, Kaufman  L, Bechor  J, Bahar  J. Comparative study of three culture systems for optimal recovery of mycobacteria from different clinical specimens. Eur J Clin Microbiol Infect Dis. 2000;19:750–4. DOIPubMedGoogle Scholar
  10. Sampaio  JL, Alves  VA, Leao  SC, De Magalhaes  VD, Martino  MD, Mendes  CM, Mycobacterium haemophilum: emerging or underdiagnosed in Brazil? Emerg Infect Dis. 2002;8:1359–60.PubMedGoogle Scholar
  11. Shah  MK, Sebti  A, Kiehn  TE, Massarella  SA, Sepkowitz  KA. Mycobacterium haemophilum in immunocompromised patients. Clin Infect Dis. 2001;33:330–7. DOIPubMedGoogle Scholar
  12. Dobos  KM, Quinn  FD, Ashford  DA, Horsburgh  CR, King  CH. Emergence of a unique group of necrotizing mycobacterial diseases. Emerg Infect Dis. 1999;5:367–78. DOIPubMedGoogle Scholar
  13. von Reyn  CF, William  DE, Horsburgh  CR Jr, Jaege  AS, Mars  BJ, Haslov  K, Dual skin testing with Mycobacterium avium sensitin and purified protein derivative to discriminate pulmonary disease due to M. avium complex from pulmonary disease due to Mycobacterium tuberculosis. J Infect Dis. 1998;177:730–6. DOIPubMedGoogle Scholar
  14. Hansen  KN, Heltberg  I, Hjelt  K. Sensitivity to tuberculin and sensitins from atypical mycobacteria (M. chelonae subsp. abscessus, M. avium, M. intracellulare, M. scrofulaceum) in 100 Danish school children. Dan Med Bull. 1989;36:399–401.PubMedGoogle Scholar
  15. Kubica  GP, Dye  WE, Cohn  ML, Middlebrook  G. Sputum digestion and decontamination with N-acetyl-L-cysteine-sodium hydroxide for culture of mycobacteria. Am Rev Respir Dis. 1963;87:775–9.PubMedGoogle Scholar
  16. Tortoli  E, Mariottini  A, Mazzarelli  G. Evaluation of INNO-LiPA MYCOBACTERIA v2: improved reversehybridization multiple DNA probe assay for mycobacterial identification. J Clin Microbiol. 2003;41:4418–20. DOIPubMedGoogle Scholar
  17. Bergmans  AM, Groothedde  JW, Schellekens  JF, van Embden  JD, Ossewaarde  JM, Schouls  LM. Etiology of cat scratch disease: comparison of polymerase chain reaction detection of Bartonella (formerly Rochalimaea) and Afipia felis DNA with serology and skin tests. J Infect Dis. 1995;171:916–23. DOIPubMedGoogle Scholar
  18. Boom  R, Sol  CJ, Salimans  MM, Jansen  CL, Wertheim-van Dillen  PM, van der Noordaa  J. Rapid and simple method for purification of nucleic acids. J Clin Microbiol. 1990;28:495–503.PubMedGoogle Scholar
  19. Frothingham  R, Wilson  KH. Sequence-based differentiation of strains in the Mycobacterium avium complex. J Bacteriol. 1993;175:2818–25.PubMedGoogle Scholar
  20. Kuijper  EJ, Stevens  S, Imamura  T, De Wever  B, Claas  EC. Genotypic identification of erythromycin-resistant Campylobacter isolates as Helicobacter species and analysis of resistance mechanism. J Clin Microbiol. 2003;41:3732–6. DOIPubMedGoogle Scholar
  21. Roth  A, Fischer  M, Hamid  ME, Michalke  S, Ludwig  W, Mauch  H. Differentiation of phylogenetically related slowly growing mycobacteria based on 16S-23S rRNA gene internal transcribed spacer sequences. J Clin Microbiol. 1998;36:139–47.PubMedGoogle Scholar
  22. Rozen  S, Skaletsky  HJ. Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S, editors. Bioinformatics methods and protocols: methods in molecular biology. Totowa (NJ): Humana Press; 2000. p. 365–86.
  23. Kutyavin  IV, Afonina  IA, Mills  A, Gorn  VV, Lukhtanov  EA, Belousov  ES, 3'-minor groove binder-DNA probes increase sequence specificity at PCR extension temperatures. Nucleic Acids Res. 2000;28:655–61. DOIPubMedGoogle Scholar
  24. Wolinsky  E. Mycobacterial lymphadenitis in children: a prospective study of 105 nontuberculous cases with long-term follow-up. Clin Infect Dis. 1995;20:954–63. DOIPubMedGoogle Scholar
  25. Smith  S, Taylor  GD, Fanning  EA. Chronic cutaneous Mycobacterium haemophilum infection acquired from coral injury. Clin Infect Dis. 2003;37:e100–1. DOIPubMedGoogle Scholar
  26. Falkinham  JO III, Norton  CD, LeChevallier  MW. Factors influencing numbers of Mycobacterium avium, Mycobacterium intracellulare, and other mycobacteria in drinking water distribution systems. Appl Environ Microbiol. 2001;67:1225–31. DOIPubMedGoogle Scholar
  27. Pai  HH, Chen  WC, Peng  CF. Isolation of non-tuberculous mycobacteria from hospital cockroaches (Periplaneta americana). J Hosp Infect. 2003;53:224–8. DOIPubMedGoogle Scholar
  28. Chang  CT, Wang  LY, Liao  CY, Huang  SP. Identification of nontuberculous mycobacteria existing in tap water by PCR-restriction fragment length polymorphism. Appl Environ Microbiol. 2002;68:3159–61. DOIPubMedGoogle Scholar
  29. Covert  TC, Rodgers  MR, Reyes  AL, Stelma  GN Jr. Occurrence of nontuberculous mycobacteria in environmental samples. Appl Environ Microbiol. 1999;65:2492–6.PubMedGoogle Scholar
  30. Carson  LA, Bland  LA, Cusick  LB, Favero  MS, Bolan  GA, Reingold  AL, Prevalence of nontuberculous mycobacteria in water supplies of hemodialysis centers. Appl Environ Microbiol. 1988;54:3122–5.PubMedGoogle Scholar
  31. Vadney  FS, Hawkins  JE. Evaluation of a simple method for growing Mycobacterium haemophilum. J Clin Microbiol. 1985;22:884–5.PubMedGoogle Scholar
  32. Murray  PR. Manual of clinical microbiology, 8th ed. Washington: ASM Press; 2003.
  33. Dawson  DJ, Jennis  F. Mycobacteria with a growth requirement for ferric ammonium citrate, identified as Mycobacterium haemophilum. J Clin Microbiol. 1980;11:190–2.PubMedGoogle Scholar
  34. McBride  JA, McBride  M, Wolf  JE. Evaluation of commercial blood-containing media for cultivation of Mycobacterium haemophilum. Am J Clin Pathol. 1992;98:282–6.PubMedGoogle Scholar
  35. Kvaerner  KJ, Kvestad  E, Orth  M. Surgery required to verify atypical mycobacterial infections. Int J Pedriatr. Otorhinolaryngology. 2001;61:121–8.
  36. Rahal  A, Abela  A, Arcand  PH, Quintal  MC, Lebl  MH, Tapier  BF. Nontuberculous mycobacterial adenitis of the head and neck in children. Laryngoscope. 2001;111:1791–6. DOIPubMedGoogle Scholar
  37. Berger  C, Pfyffer  GE, Nadal  D. Treatment of nontuberculous mycobacterial lymphadenitis with clarithromycin plus rifabutin. J Pediatr. 1996;128:383–6. DOIPubMedGoogle Scholar
  38. Lindeboom  JA, de Lange  J, van den Akker  HP. Clarithromycin as a single-modality treatment in mycobacterial avium-intracellulare infections. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 1999;87:50–4. DOIPubMedGoogle Scholar

Main Article

Page created: April 14, 2011
Page updated: April 14, 2011
Page reviewed: April 14, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external