Volume 13, Number 5—May 2007
Dispatch
Chikungunya Virus in US Travelers Returning from India, 2006
Robert S. Lanciotti*
, Olga L. Kosoy*, Janeen J. Laven*, Amanda J. Panella*, Jason O. Velez*, Amy J. Lambert*, and Grant L. Campbell*
, Olga L. Kosoy*, Janeen J. Laven*, Amanda J. Panella*, Jason O. Velez*, Amy J. Lambert*, and Grant L. Campbell*
Table 2
Sensitivity and specificity of chikungunya virus (CHIKV) oligonucleotide primers used in real-time reverse transcription–PCR assay
| Primer | Genome position* | Sequence (5′→3′) | Sensitivity† | Specificity‡ |
|---|---|---|---|---|
| CHIKV 874 |
874–894 |
AAAGGGCAAACTCAGCTTCAC |
||
| CHIKV 961 |
961–942 |
GCCTGGGCTCATCGTTATTC |
0.3 |
CHIKV |
| CHIKV 899-FAM§ |
899–923 |
CGCTGTGATACAGTGGTTTCGTGTG |
||
| CHIKV 6856 |
6856–6879 |
TCACTCCCTGTTGGACTTGATAGA |
||
| CHIKV 6981 |
6981–6956 |
TTGACGAACAGAGTTAGGAACATACC |
0.9 |
CHIKV |
| CHIKV 6919-FAM | 6919–6941 | AGGTACGCGCTTCAAGTTCGGCG |
*On the basis of CHIKV prototype strain S27, GenBank accession no. NC_004162.
†Absolute no. of PFU detected in triplicate testing.
‡No reactivity was observed with the following viruses: o’nyong nyong, Ross River, Mayaro, Semliki Forest, Sindbis, western
equine encephalitis, eastern equine encephalitis, and Venezuelan equine encephalitis subtypes 1AB, 1C, 1D, and 1E.
§Primer labeled at the 5′ terminus with 5-FAM and 3′ Black Hole Quencher 1 (Operon Biotechnologies Inc., Huntsville, AL, USA).
Page created: June 24, 2010
Page updated: June 24, 2010
Page reviewed: June 24, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.