Volume 15, Number 1—January 2009
Dispatch
Clonal Multidrug-Resistant Corynebacterium striatum Strains, Italy
Floriana Campanile, Edoardo Carretto, Daniela Barbarini, Annalisa Grigis, Marco Falcone, Antonio Goglio, Mario Venditti, and Stefania Stefani
Table 1
Primer conditions, PCR products, and related sequences confirmed by BLAST analysis of 36 strains of multidrug-resistant Corynebacterium striatum, Italy, 2005–2007*
| Primer | Related resistance | Sequence (5′ → 3′) | Temperature, °C | Size, bp | BLAST from–to, bp |
|---|---|---|---|---|---|
| ermX up ermX down | Erythromycin and clindamycin | AACCATGATTGTGTTTCTGAACG ACCAGGAAGCGGTGCCCT | 57 | 566 | 2,285–2,850 |
| tetA up tetB down | Tetracycline, oxytetracycline, and oxacillin | TTAGCGTTCGGCGACCTGG AACTGGGTGCCTTCAGGGTC | 58 | 1,829 | 5,496–7,324 |
| cmxB up cmxA down | Cloramphenicol (2 identical subunits) | AGTCGGTATGGTCGTCGGC GCTCCGATATTCAATGCTGCG | 57 | 879 | 16,031–16,909 36,078–36,956 |
| aphA1 up aphA1 down | Aminoglycoside | GGCAAGATCCTGGTATCGGTCT AGACTAAACTGGCTGACGGCAT | 57 | 480 | 41,859–42,338 |
| repB up repB down | Replicase | CGATCTGGAATTTGTCTGCCGT CTGGTTGATAGACCCCGTGT | 57 | 875 | 32,523–33,397 |
*BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi) analysis of each gene with pTP10 sequence (GenBank accession no. AF024666) showed nucleotide identities >99%.
Page created: December 06, 2010
Page updated: December 06, 2010
Page reviewed: December 06, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.