Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 15, Number 4—April 2009
Research

Hantavirus Pulmonary Syndrome, Central Plateau, Southeastern, and Southern Brazil

Luiz T.M. FigueiredoComments to Author , Marcos L. Moreli, Ricardo L.M. de Sousa, Alessandra A. Borges, Glauciane G. de Figueiredo, Alex M. Machado, Ivani Bisordi, Teresa K. Nagasse-Sugahara, Akemi Suzuki, Luiz E. Pereira, Renato P. de Souza, Luiza T.M. de Souza, Carla T. Braconi, Charlotte M. Harsi, Paolo M. de Andrade Zanotto, and the Viral Diversity Genetic Network Consortium
Author affiliations: University of São Paulo School of Medicine, Ribeirão Preto, Brazil (L.T.M. Figueiredo, M.L. Moreli, R.L.M. de Sousa, A.A. Borges, G.G. de Figueiredo, A.M. Machado); Adolfo Lutz Institute, São Paulo, Brazil (I. Bisordi, T.K. Nagasse-Sugahara, A. Suzuki, L.E. Pereira, R.P. de Souza, L.T.M. de Souza); University of São Paulo, São Paulo (C.T. Braconi, C.M. Harsi, P.M. de Andrade Zanotto)

Main Article

Table 1

Primers used for reverse transcription–PCR of hantaviruses, Brazil, 1998–2007

Gene*/primer Sequence (5′ → 3′) Nucleotide annealing site
N/SAHN-C CAAAACCAGTTGATCAACAGGG 213–236 of hantavirus small RNA segment
N/SAHN-S GATGAATCATCCTTGAACCTTAT 454–477 of hantavirus small RNA segment
G1/HANGn-C GGGCAGTAAGTGCTGAAAC 1301–1320 of hantavirus medium RNA segment
G1/HANGn-S ACATTTAGCAGTTTGCCATGGG 1602–1625 of hantavirus medium RNA segment

*N, nucleocapsid; G1, glycoprotein 1.

Main Article

Page created: December 10, 2010
Page updated: December 10, 2010
Page reviewed: December 10, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external