Volume 15, Number 4—April 2009
THEME ISSUE
The Amazon Region
Research
Human Febrile Illness Caused by Encephalomyocarditis Virus Infection, Peru
Table
Oligonucleotide primers used for cardiovirus PCR amplification and sequencing*
Primer | Sequence (5′ → 3′) | Region | Coordinates | Reference |
---|---|---|---|---|
AN312 | GARTVWCGYRAAGRAAGCAGT | 5′-NTR | 455–475 | This study |
AN315 | GGYRCTGGGGTTGYRCCGC | 5′-NTR | 618–600 | This study |
AN283 | GCAGACGGWTGGGTNACNGTNTGG | VP3 | 2559–2582 | This study |
AN285 | AGAGTAACCTCTACRTCRCAYTTRTA | VP1 | 3097–3072 | This study |
AN393 | TTTCCACTCAAGTCTAARCARGAYT | VP1 | 3015–3049 | This study |
AN286 | AAGAAGACAGTCGGACGNGGRCARAANAC | VP1 | 3472–3444 | This study |
P1 | CCCTACCTCACGGAATGGGGCAAAG | 3D | 7655–7631 | (24) |
P2 | GGTGAGAGCAAGCCTCGCAAAGACAG | 3D | 7370–7395 | (24) |
*NTR, nontranslated region; VP1, viral protein 1.
References
- Tesh RB, Wallace GD. Observations on the natural history of encephalomyocarditis virus. Am J Trop Med Hyg. 1978;27:133–43.PubMedGoogle Scholar
- Grobler DG, Raath JP, Braack LE, Keet DF, Gerdes GH, Barnard BJ, An outbreak of encephalomyocarditis-virus infection in free-ranging African elephants in the Kruger National Park. Onderstepoort J Vet Res. 1995;62:97–108.PubMedGoogle Scholar
- Helwig FC, Schmidt CH. A filter-passing agent producing interstitial myocarditis in anthropoid apes and small animals. Science. 1945;102:31–3. DOIPubMedGoogle Scholar
- Hubbard GB, Soike KF, Butler TM, Carey KD, Davis H, Butcher WI, An encephalomyocarditis virus epizootic in a baboon colony. Lab Anim Sci. 1992;42:233–9.PubMedGoogle Scholar
- Reddacliff LA, Kirkland PD, Hartley WJ, Reece RL. Encephalomyocarditis virus infections in an Australian zoo. J Zoo Wildl Med. 1997;28:153–7.PubMedGoogle Scholar
- Roca-Garcia M, Sanmartin-Barber C. The isolation of encephalomyocarditis virus from Aotus monkeys. Am J Trop Med Hyg. 1957;6:840–52.PubMedGoogle Scholar
- Jones P, Mahamba C, Rest J, André C. Fatal inflammatory heart disease in a bonobo (Pan paniscus). J Med Primatol. 2005;34:45–9. DOIPubMedGoogle Scholar
- Murnane TG, Craighead JE, Mondragon H, Shelokov A. Fatal disease of swine due to encephalomyocarditis virus. Science. 1960;131:498–9. DOIPubMedGoogle Scholar
- Seaman JT, Boulton JG, Carrigan MJ. Encephalomyocarditis virus disease of pigs associated with a plague of rodents. Aust Vet J. 1986;63:292–4. DOIPubMedGoogle Scholar
- Dick GWA, Best AM, Haddow AJ, Smithburn KC. Mengo encephalomyelitis, a hitherto unknown virus affecting man. Lancet. 1948;252:286–9. DOIGoogle Scholar
- Gajdusek DC. Encephalomyocarditis virus infection in childhood. Pediatr. 1955;16:902–6.
- Verlinde JD, Tongeren V. Human infection with viruses of the Columbia SK group. Arch Gesamte Virusforsch. 1953;5:217–27. DOIPubMedGoogle Scholar
- Jones MS, Lukashov VV, Ganac RD, Schnurr DP. Discovery of a novel human picornavirus in a stool sample from a pediatric patient presenting with fever of unknown origin. J Clin Microbiol. 2007;45:2144–50. DOIPubMedGoogle Scholar
- Abed Y, Boivin G. New Saffold cardioviruses in 3 children, Canada. Emerg Infect Dis. 2008;14:834–6. DOIPubMedGoogle Scholar
- Drexler JF, Luna LK, Stöcker A, Silva Almeida PS, Medrado Ribeiro TC, Petersen N, Circulation of 3 lineages of a novel human Saffold cardiovirus in humans. Emerg Infect Dis. 2008;14:1398–405. DOIPubMedGoogle Scholar
- Chiu CY, Greninger AL, Kanada K, Kwok T, Fisher KF, Runckel C, Identification of cardioviruses related to Theiler's murine encephalomyelitis virus in human infections. Proc Natl Acad Sci U S A. 2008;105:14124–9. DOIPubMedGoogle Scholar
- Jonkers AH. Serosurvey of encephalomyocarditis virus neutralizing antibodies in southern Louisiana and Peruvian Indian populations. Am J Trop Med Hyg. 1961;10:593–8.PubMedGoogle Scholar
- Jungblut CW, Bautista G Jr. Antibodies against Col-SK virus in Mexican sera. Am J Trop Med Hyg. 1954;3:466–74.PubMedGoogle Scholar
- Gajdusek DC, Rogers NG. Specific serum antibodies to infectious disease agents in Tarahumara Indian adolescents of northwestern Mexico. Pediatr. 1955;16:819–35.
- Seligmann E, Jungblut CW. Neutralization of SK murine poliomyelitis virus and of Theiler's virus of mouse encephalomyelitis by human sera. Am J Public Health. 1943;33:1326–32. DOIGoogle Scholar
- Smithburn KC. Neutralizing antibodies against certain recently isolated viruses in the sera of human beings residing in East Africa. J Immunol. 1952;69:223–34.PubMedGoogle Scholar
- Tesh RB. The prevalence of encephalomyocarditis virus neutralizing antibodies among various human populations. Am J Trop Med Hyg. 1978;27:144–9.PubMedGoogle Scholar
- Gubler DJ, Kuno G, Sather GE, Velez M, Oliver A. Mosquito cell cultures and specific monoclonal antibodies in surveillance for dengue viruses. Am J Trop Med Hyg. 1984;33:158–65.PubMedGoogle Scholar
- Koenen F, Vanderhallen H, Dickenson ND, Knowles NJ. Phylogenetic analysis of European encephalomyocarditis viruses: comparison of two genomic regions. Arch Virol. 1999;144:893–903. DOIPubMedGoogle Scholar
- Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997;25:4876–82. DOIPubMedGoogle Scholar
- Sutter RW, Pallansch MA, Sawyer LA, Cochi SL, Hadler SC. Defining surrogate serologic tests with respect to predicting protective vaccine efficacy: poliovirus vaccination. Ann N Y Acad Sci. 1995;754:289–99. DOIPubMedGoogle Scholar
- Finney DJ. Statistical methods in biological assays. 2nd ed. New York: Hafner Publishing; 1964.
- Kuno G, Gomez I, Gubler DJ. Detecting artificial anti-dengue IgM immune complexes using an enzyme-linked immunosorbent assay. Am J Trop Med Hyg. 1987;36:153–9.PubMedGoogle Scholar
- Bienz K, Egger D, Pasamontes L. Association of polioviral proteins of the P2 genomic region with the viral replication complex and virus-induced membrane synthesis as visualized by electron microscopic immunocytochemistry and autoradiography. Virology. 1987;160:220–6. DOIPubMedGoogle Scholar
- Hirasawa K, Takeda M, Matsuzaki H, Doi K. Encephalomyocarditis (EMC) virus-induced orchitis in Syrian hamsters. Int J Exp Pathol. 1991;72:617–22.PubMedGoogle Scholar
- Altman R. Clinical aspects of enterovirus infection. Postgrad Med. 1964;35:451–9.PubMedGoogle Scholar
- Harb JM, Hiramoto Y, Burch GE. Phagocytosis of injured hepatocytes following inoculation with encephalomyocarditis virus. Exp Mol Pathol. 1974;20:199–207. DOIPubMedGoogle Scholar
- Thoren A, Robinson AJ, Maguire T, Jenkins R. Two-step PCR in the retrospective diagnosis of enteroviral viraemia. Scand J Infect Dis. 1992;24:137–41. DOIPubMedGoogle Scholar
- Prather SL, Dagan R, Jenista JA, Menegus MA. The isolation of enteroviruses from blood: a comparison of four processing methods. J Med Virol. 1984;14:221–7. DOIPubMedGoogle Scholar
Page created: December 10, 2010
Page updated: December 10, 2010
Page reviewed: December 10, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.