Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 15, Number 5—May 2009

Research

Chloroquine-Resistant Haplotype Plasmodium falciparum Parasites, Haiti

Berlin L. Londono, Thomas P. Eisele, Joseph Keating, Adam Bennett, Chandon Chattopadhyay, Gaetan Heyliger, Brian Mack, Ian Rawson, Jean-Francois Vely, Olbeg Désinor, and Donald J. KrogstadComments to Author 
Author affiliations: Tulane University, New Orleans, Louisiana, USA (B.L. Londono, T.P. Eisele, J. Keating, A. Bennett, B. Mack, D.J. Krogstad); University of Pamplona, Pamplona, Colombia (B.L. Londono); Hôpital Albert Schweitzer, Deschapelles, Haiti (C. Chattopadhyay, G. Heyliger, I. Rawson); Swiss Tropical Institute, Basel, Switzerland (C. Chattopadhyay); Ministry of Health, Port-au-Prince, Haiti (J.-F. Vely); US Agency for International Development, Port-au-Prince (O. Désinor)

Main Article

Table 1

Primers used to amplify Plasmodium falciparum DNA during study in Haiti*

Primers (5′ → 3′) Amplicon, bp Tm, °C Reference
Primers for P. falciparum species-specific SSU rRNA gene 276 (22)
Forward: AACAGACGGGTAGTCATGATTGAG 56.5
Reverse: GTATCTGATCGTCTTCACTCCC 54.5
Primers for single-step pfcrt gene PCR 170 (23)
Forward: TgTgCTCATgTGTTTAAACTT 50.6
Reverse: AATAAAgTTgTgAgTTTCggA 49.8
Primers for nested (2-step) pfcrt gene 573 (24,25)
First round of amplification
Forward (CRTP1): CCGTTAATAATAAATACACGCAG 49.9
Reverse (CRTP2): CGGATGTTACAAAACTATAGTTACC 51.5
Second round of amplification
Forward (CRTD1): TGTGCTCATGTGTTTAAACTT 134 50.6
Reverse (CRTD2): CAAAACTATAGTTACCAATTTTG 46.1

*Nucleotides in upper case letters were conserved in 100% of sequences at those positions, and nucleotides in lower case letters were conserved in most (e.g., >50%) sequences at those positions. Tm, melting (annealing) temperature; SSU, small subunit; pfcrt, P. falciparum chloroquine resistance transporter.

Main Article

References
  1. Greenwood  BM. The epidemiology of malaria. Ann Trop Med Parasitol. 1997;91:763–9. DOIPubMedGoogle Scholar
  2. García-Martin  G. Status of malaria eradication in the Americas. Am J Trop Med Hyg. 1972;21:617–33.PubMedGoogle Scholar
  3. Duverseau  YT, Magloire  R, Zevallos-Ipenza  A, Rogers  HM, Nguyen-Dinh  P. Monitoring of chloroquine sensitivity of Plasmodium falciparum in Haiti, 1981–1983. Am J Trop Med Hyg. 1986;35:459–64.PubMedGoogle Scholar
  4. Pan American Health Organization. Roll back malaria in Meso America: report on the meeting held in the Dominican Republic with the participation of the Central American countries, Mexico, Haiti and the Dominican Republic, November 20–24, 2000. San Pedro de Macoris (Dominican Republic): The Organization; 2000.
  5. Lindo  JF, Bryce  JH, Ducasse  MB, Howitt  C, Barrett  DM, Lorenzo Morales  J, Plasmodium malariae in Haitian refugees, Jamaica. Emerg Infect Dis. 2007;13:931–3.PubMedGoogle Scholar
  6. Magloire  R, Nguyen-Dinh  P. Chloroquine susceptibility of Plasmodium falciparum in Haiti. Bull World Health Organ. 1983;61:1017–20.PubMedGoogle Scholar
  7. Bonnlander  H, Rossignol  AM, Rossignol  PA. Malaria in central Haiti: a hospital-based retrospective study, 1982–1986 and 1988–1991. Bull Pan Am Health Organ. 1994;28:9–16.PubMedGoogle Scholar
  8. Drabick  JJ, Gambel  JM, Huck  E, De Young  S, Hardeman  L. Microbiological laboratory results from Haiti: June–October 1995. Bull World Health Organ. 1997;75:109–15.PubMedGoogle Scholar
  9. Raccurt  C. Malaria in Haiti today [in French]. Sante. 2004;14:201–4.PubMedGoogle Scholar
  10. Meeting of the International Task Force for Disease Eradication—12 May 2006. Wkly Epidemiol Rec. 2007;82:25–30.PubMedGoogle Scholar
  11. Eisele  TP, Keating  J, Bennett  A, Londono  B, Johnson  D, Lafontant  C, Prevalence of Plasmodium falciparum infection in rainy season, Artibonite Valley, Haiti, 2006. Emerg Infect Dis. 2007;13:1494–6.PubMedGoogle Scholar
  12. Keating  J, Eisele  TP, Bennett  A, Johnson  D, Macintrye  K. A description of malaria-related knowledge, perceptions, and practices in the Artibonite Valley of Haiti: implications for malaria control. Am J Trop Med Hyg. 2008;78:262–9.PubMedGoogle Scholar
  13. Caillouët  KA, Keating  J, Eisele  TP. Characterization of aquatic mosquito habitat, natural enemies, and immature mosquitoes in the Artibonite Valley, Haiti. J Vector Ecol. 2008;33:191–7. DOIPubMedGoogle Scholar
  14. Centers for Disease Control and Prevention. Health information for travelers to Haiti [cited 2008 Dec 23]. Available from http://wwwn.cdc.gov/travel/destinationHaiti.aspx
  15. Hobbs  JH, Sexton  JD, St Jean  Y, Jacques  JR. The biting and resting behavior of Anopheles albimanus in northern Haiti. J Am Mosq Control Assoc. 1986;2:150–3.PubMedGoogle Scholar
  16. Krogstad  DJ, Joseph  VR, Newton  LH. A prospective study of the effects of ultralow volume (ULV) aerial application of malathion on epidemic Plasmodium falciparum: IV. Epidemiologic aspects. Am J Trop Med Hyg. 1975;24:199–205.PubMedGoogle Scholar
  17. Rossignol  AM, Rossignol  PA. Malaria in central Haiti: a hospital-based retrospective study, 1982–1986 and 1988–1991. Bull Pan Am Health Organ. 1994;28:9–16.PubMedGoogle Scholar
  18. Nicolas  E, Jean-Francois  V, Benitez  A, Bloland  PB, Saint Jean  Y, Mount  DL, Prevalence of malaria parasitemia and accuracy of microscopic diagnosis in Haiti, October 1995. Rev Panam Salud Publica. 1998;3:35–9.PubMedGoogle Scholar
  19. Wongsrichanalai  C, Barcus  MJ, Muth  S, Sutamihardja  A, Wernsdorfer  WH. A review of malaria diagnostic tools: microscopy and rapid diagnostic test (RDT). Am J Trop Med Hyg. 2007;77(Suppl):119–27.PubMedGoogle Scholar
  20. Wooden  J, Gould  EE, Paull  AT, Sibley  CH. Plasmodium falciparum: a simple polymerase chain reaction method for differentiating strains. Exp Parasitol. 1992;75:207–12. DOIPubMedGoogle Scholar
  21. Colborn  JM, Koita  OA, Cissé  OH, Bagayoko  MW, Guthrie  EJ, Krogstad  DJ. Identifying and quantifying genotypes in polyclonal infections due to single species. Emerg Infect Dis. 2006;12:475–82.PubMedGoogle Scholar
  22. Padley  D, Moody  AH, Chiodini  PL, Saldanha  J. Use of a rapid-single-round, multiplex PCR to detect malarial parasites and identify the species present. Ann Trop Med Parasitol. 2003;97:131–7. DOIPubMedGoogle Scholar
  23. Bertin  G, Ndam  NT, Jafarei-Guemouri  S, Fievet  N, Renart  E, Sow  S, High prevalence of Plasmodium falciparum pfcrt K76T mutation in pregnant women taking chloroquine prophylaxis in Senegal. J Antimicrob Chemother. 2005;55:788–91. DOIPubMedGoogle Scholar
  24. Djimde  A, Doumbo  OK, Corteste  JF, Kayentao  K, Doumbo  S, Diourte  Y, A molecular marker for chloroquine-resistant falciparum malaria. N Engl J Med. 2001;344:257–63. DOIPubMedGoogle Scholar
  25. Maguire  JD, Susanti  AI. Krisin, Sismadi P, Fryauff DJ, Baird JK. The T76 mutation in the pfcrt gene of Plasmodium falciparum and clinical chloroquine resistance phenotypes in Papua, Indonesia. Ann Trop Med Parasitol. 2001;95:559–72. DOIPubMedGoogle Scholar
  26. Collins  WE, Chin  W, Warren  M, Huong  AY, Jeffery  GM, Skinner  JC. Observations on two strains of Plasmodium falciparum from Haiti in Aotus monkeys. J Parasitol. 1982;68:657–67. DOIPubMedGoogle Scholar
  27. Bruce  MC, Galinski  MR, Barnwell  JW, Donnelly  CA, Walmsley  M, Alpers  MP, Genetic diversity and dynamics of Plasmodium falciparum and P. vivax populations in multiply infected children with asymptomatic malaria infections in Papua New Guinea. Parasitology. 2000;121:257–72. DOIPubMedGoogle Scholar
  28. Mehlotra  RK, Lorry  K, Kastens  W, Miller  SM, Alpers  MP, Bockarie  M, Random distribution of mixed species malaria infections in Papua New Guinea. Am J Trop Med Hyg. 2000;62:225–31.PubMedGoogle Scholar
  29. Abdel-Latif  MS, Khattab  A, Lindenthal  C, Kremsner  PG, Klinkert  M-Q. Recognition of variant rifin antigens by human antibodies induced during natural Plasmodium falciparum infections. Infect Immun. 2002;70:7013–21. DOIPubMedGoogle Scholar
  30. Juliano  JJ, Trottman  P, Mwapasa  V, Meshnick  SR. Detection of the dihydrofolate reductase-164L mutation in Plasmodium falciparum infections from Malawi by heteroduplex tracking assay. Am J Trop Med Hyg. 2008;78:892–4.PubMedGoogle Scholar
  31. Burland  TG. DNASTAR’s Lasergene sequence analysis software. Methods Mol Biol. 2000;132:71–91.PubMedGoogle Scholar
  32. Rich  SM, Ferreira  MU, Ayala  FJ. The origin of antigenic diversity in Plasmodium falciparum. Parasitol Today. 2000;16:390–6. DOIPubMedGoogle Scholar
  33. Collins  WE, Campbell  CC, Skinner  JC, Chin  W, Nguyen-Dinh  P, Huong  AY. Studies on the Indochina I/CDC strain of Plasmodium falciparum in Colombian and Bolivian Aotus monkeys and different anophelines. J Parasitol. 1983;69:186–90. DOIPubMedGoogle Scholar
  34. Fidock  DA, Nomura  T, Talley  AK, Cooper  RA, Dzekunov  SM, Ferdig  MT, Mutations in the P. falciparum digestive vacuole transmembrane protein PfCRT and evidence for their role in chloroquine resistance. Mol Cell. 2000;6:861–71. DOIPubMedGoogle Scholar
  35. Lakshmanan  V, Bray  PG, Verdier-Pinard  D, Johnson  DJ, Horrocks  P, Muhle  RA, A critical role for PfCRT K76T in Plasmodium falciparum verapamil-reversible chloroquine resistance. EMBO J. 2005;24:2294–305. DOIPubMedGoogle Scholar
  36. Pillai  DR, Labbe  AC, Vanisaveth  V, Hongvangthong  B, Pomphida  S, Indatghone  S, Plasmodium falciparum malaria in Laos: chloroquine treatment outcome and predictive value of molecular markers. J Infect Dis. 2001;183:789–95. DOIPubMedGoogle Scholar
  37. Mayor  AG, Gomez-Olive  X, Aponte  JJ, Casimiro  S, Mabunda  S, Dgedge  M, Prevalence of the K76T mutation in the putative Plasmodium falciparum chloroquine resistance transporter (pfcrt) gene and its relation to chloroquine resistance in Mozambique. J Infect Dis. 2001;183:1413–6. DOIPubMedGoogle Scholar
  38. Durand  R, Jafari  S, Vauzelle  J, Delabre  JF, Jesic  Z, Le Bras  J. Analysis of pfcrt point mutations and chloroquine susceptibility in isolates of Plasmodium falciparum. Mol Biochem Parasitol. 2001;114:95–102. DOIPubMedGoogle Scholar
  39. Mayxay  M, Nair  S, Sudimack  D, Imwong  M, Tanomsing  N, Pongvongsa  T, Combined molecular and clinical assessment of Plasmodium falciparum antimalarial drug resistance in the Lao People’s Democratic Republic. Am J Trop Med Hyg. 2007;77:36–43.PubMedGoogle Scholar
  40. Prevention of malaria. Med Lett Drugs Ther. 2005;47:100–2.PubMedGoogle Scholar

Main Article

Page created: December 16, 2010
Page updated: December 16, 2010
Page reviewed: December 16, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external