Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 16, Number 3—March 2010

Research

Blood Meal Analysis to Identify Reservoir Hosts for Amblyomma americanum Ticks

Brian F. AllanComments to Author , Lisa S. Goessling, Gregory A. Storch, and Robert E. Thach
Author affiliations: Washington University in St. Louis, St. Louis, Missouri, USA (B.F. Allan, L.S. Goessling, R.E. Thach); St. Louis Children’s Hospital, St. Louis (G.A. Storch)

Main Article

Table 1

Oligonucleotide sequences of bacterial probes used in reverse line blot assay

Probe ID Nucleotide sequence (5′ → 3′) Target organism (RNA genes) Reference sequence
Ptg011 aacatgaacatctaaaaacataaa Borrelia garinii (23S–5S) *
Ptg012 aacatttaaaaaataaattcaagg B. afzelii (23S–5S) *
Ptg013 cattaaaaaaatataaaaaataaatttaagg B. valaisiana (23S–5S) *
Ptg009 ctttgaccatatttttatcttcca B. burgdorferi s.l. (23S––5S) *
Ptg010 aacaccaatatttaaaaaacataa B. burgdorferi s.s. (23S–5S) *
Ptg003 cgaacttctgggtcaagac B. burgdorferi s.l. (16S) †
Ptg020 agataactactctccgtttg B. lonestari (16S) AY166715
Ptg022 tcctaatagggggagtc Ehrlichia chaffeensis (16S) M73222
Ptg023 cttttaacagagggagtca E. ewingii (16S) M73227
Ptg024 tcctaacagggggagtc E. canis/ovina/muris (16S) AY394465, AY318946, ABO13009
Ptg007 tggggattttttatctctgtg Anaplasma phagocytophilum (16S) †
Ptg021 ctaccactgacgctgat Rickettsia rickettsii (16S) DQ150694
Ptg027 cttcggaacgcagtgac Francisella tularensis + F. philomiragia (16S) Z21932, Z21933
Ptg026 cttggggaggacgttac F. tularensis subsp. tularensis (16S) Z21932
Ptg029 gcctatragttaatagcttgt F. philomiragia (16S) Z21933
Ptg028 tcctgcgatctttctaga F. endosymbiont of Dv (16S) AF166256
Ptg032 catccagggaagtaagc Arsenophonus spp. (16S) AY265347
Ptg030 gctacaactgacactgatg R. endosymbiont of Dv (16S) AY375427
Ptg031 tacaactgacgctaatgc R. amblyommii + Rickettsia sp. (16S) U11012
Ptg035 tcggaagattatctttcgg R. amblyommii (16S) U11012

*Designed by Rijpkema et al. 1995 (23).
†Designed by Pichon et al. 2003 (13).

Main Article

References
  1. Jones  KE, Patel  NG, Levy  MA. Global trends in emerging infectious diseases. Nature. 2008;451:990–4. DOIPubMedGoogle Scholar
  2. Ostfeld  RS, Keesing  F, Schauber  EM, Schmidt  KA. The ecological context of infectious disease: diversity, habitat fragmentation, and Lyme disease risk in North America. In: Aguirre A, Ostfeld RS, Tabor G, House CA, Pearl M, editors. Conservation medicine: ecological health in practice. New York: Oxford University Press; 2002. p. 207–19.
  3. Patz  JA, Daszak  P, Tabor  GM, Aguirre  AA, Pearl  M, Epstein  J, Unhealthy landscape: policy recommendations on land use change and infectious disease emergence. Environ Health Perspect. 2004;112:1092–8.PubMedGoogle Scholar
  4. Dobson  A, Cattadori  I, Holt  RD, Ostfeld  RS, Keesing  F, Krichbaum  K, Sacred cows and sympathetic squirrels: the importance of biological diversity to human health. PLoS Med. 2006;3:e231. DOIPubMedGoogle Scholar
  5. Childs  JE, Paddock  CD. The ascendancy of Amblyomma americanum as a vector of pathogens affecting humans in the United States. Annu Rev Entomol. 2003;48:307–37. DOIPubMedGoogle Scholar
  6. Long  SW, Zhang  X, Zhang  J, Ruble  RP, Teel  P, Yu  XJ. Evaluation of transovarial transmission and transmissibility of Ehrlichia chaffeensis (Rickettsiales: Anaplasmataceae) in Amblyomma americanum (Acari: Ixodidae). J Med Entomol. 2003;40:1000–4. DOIPubMedGoogle Scholar
  7. Stromdahl  EY, Vince  MA, Billingsley  PM, Dobbs  NA, Williamson  PC. Rickettsia amblyommii infecting Amblyomma americanum larvae. Vector Borne Zoonotic Dis. 2008;8:1–9. DOIPubMedGoogle Scholar
  8. Paddock  CD, Yabsley  MJ. Ecological havoc, the rise of white-tailed deer, and the emergence of Amblyomma americanum-associated zoonoses in the United States. Curr Top Microbiol. 2007;315:289–324. DOIGoogle Scholar
  9. LoGiudice  K, Ostfeld  RS, Schmidt  KA, Keesing  F. The ecology of infectious disease: effects of host diversity and community composition on Lyme disease risk. Proc Natl Acad Sci U S A. 2003;100:567–71. DOIPubMedGoogle Scholar
  10. Brisson  D, Dykhuizen  DE, Ostfeld  RS. Conspicuous impacts of inconspicuous hosts on the Lyme disease epidemic. Proc R Soc Lond B Biol Sci. 2008;275:227–35. DOIGoogle Scholar
  11. Kent  RJ. Molecular methods for arthropod blood meal identification and applications to ecological and vector-borne disease studies. Mol Ecol Resour. 2009;9:4–18. DOIGoogle Scholar
  12. Pichon  B, Egan  E, Rogers  M, Gray  J. Detection and identification of pathogens and host DNA in unfed host-seeking Ixodes ricinus L. J Med Entomol. 2003;40:723–31. DOIPubMedGoogle Scholar
  13. Pichon  B, Rogers  M, Egan  D, Gray  J. Blood meal analysis for the identification of reservoir hosts for tick-borne pathogens in Ireland. Vector Borne Zoonotic Dis. 2005;5:172–80. DOIPubMedGoogle Scholar
  14. Morán Cadenas  FM, Rais  O, Humair  PF, Douet  V, Moret  J, Gern  L. Identification of host blood meal source and Borrelia burgdorferi sensu lato in field-collected Ixodes ricinus ticks in Chaumont (Switzerland). J Med Entomol. 2007;44:1109–17. DOIPubMedGoogle Scholar
  15. Humair  PF, Douet  V, Cadenas  FM, Schouls  LM, Van de Pol  I, Gern  L. Molecular identification of blood meal source in Ixodes ricinus ticks using 12S rDNA as a genetic marker. J Med Entomol. 2007;44:869–80. DOIPubMedGoogle Scholar
  16. Gray  JS, Kahl  O, Lane  RS, Stanek  G, eds. Lyme borreliosis: biology, epidemiology and control. Oxford (UK): CABI Publishing; 2002.
  17. Schulze  TL, Jordan  RA, Hung  RW. Biases associated with several sampling methods used to estimate abundance of Ixodes scapularis and Amblyomma americanum (Acari: Ixodidae). J Med Entomol. 1997;34:615–23.PubMedGoogle Scholar
  18. Keirans  JE, Durden  LA. Illustrated key to nymphs of the tick genus Amblyomma (Acari: Ixodidae) found in the United States. J Med Entomol. 1998;35:489–95.PubMedGoogle Scholar
  19. Hammer  B, Moter  A, Kahl  O, Alberti  G, Gobel  UB. Visualization of Borrelia burgdorferi sensu lato by fluorescence in situ hybridization (FISH) on whole-body sections of Ixodes ricinus ticks and gerbil skin biopsies. Microbiol. 2001;147:1425–36.
  20. Black  WC IV, Piesman  J. A phylogeny of hard and soft tick taxa based on mitochondrial 16S ribosomal DNA sequences. Proc Natl Acad Sci U S A. 1994;91:10034–8. DOIPubMedGoogle Scholar
  21. DeShields  A, Borman-Shoap  E, Peters  JE, Gaudreault-Keener  M, Arens  MQ, Storch  GA. Detection of pathogenic ehrlichia in ticks collected at acquisition sites of human ehrlichiosis in Missouri. Mo Med. 2004;101:132–7.PubMedGoogle Scholar
  22. Rijpkema  SG, Molekenboer  MJ, Schouls  LM, Jongejan  F, Schellekens  JG. Simultaneous detection and genotyping of three genomic groups of Borrelia burgdorferi sensu lato in Dutch Ixodes ricinus ticks by characterization of the amplified intergenic spacer region between 5S and 23S rRNA genes. J Clin Microbiol. 1995;33:3091–5.PubMedGoogle Scholar
  23. Hood  GM. 2008. PopTools version 3.0.6. http://www.cse.csiro.au/poptools
  24. Bacon  RM, Gilmore  RD Jr, Quintana  M, Piesman  J, Johnson  BJ. DNA evidence of Borrelia lonestari in Amblyomma americanum (Acari: Ixodidae) in southeast Missouri. J Med Entomol. 2003;40:590–2. DOIPubMedGoogle Scholar
  25. Mixson  TR, Campbell  SR, Gill  JS, Ginsberg  HS, Reichard  MV, Schulze  TL, Prevalence of Ehrlichia, Borrelia, and Rickettsial agents in Amblyomma americanum (Acari: Ixodidae) collected from nine states. Vector-Borne Zoonot. 2006;43:1261–8.
  26. Stromdahl  EY, Williamson  PC, Kollars  TM, Evans  SR, Barry  RK, Vince  MA, Evidence for Borrelia lonestari DNA in Amblyomma americanum (Acari: Ixodidae) removed from humans. J Clin Microbiol. 2003;41:5557–62. DOIPubMedGoogle Scholar
  27. Yabsley  MJ, Varela  AS, Tate  CM, Dugan  VG, Stallknecht  DE, Little  SE, Ehrlichia ewingii infection in white-tailed deer (Odocoileus virginianus). Emerg Infect Dis. 2002;8:668–71.PubMedGoogle Scholar
  28. Arens  MQ, Liddell  AM, Buening  G, Gaudreault-Keener  M, Sumner  JW, Comer  JA, Detection of Ehrlichia spp. in the blood of wild white-tailed deer in Missouri by PCR assay and serologic analysis. J Clin Microbiol. 2003;41:1263–5. DOIPubMedGoogle Scholar
  29. Moore  VA IV, Varela  AS, Yabsley  MJ, Davidson  WR, Little  SE. Detection of Borrelia lonestari, putative agent of southern tick-associated rash illness, in white-tailed deer (Odocoileus virginianus) from the southeastern United States. J Clin Microbiol. 2003;41:424–7. DOIPubMedGoogle Scholar
  30. Brunner  JL, LoGuidice  KL, Ostfeld  RS. Estimating reservoir competence of Borrelia burgdorferi hosts: prevalence and infectivity, sensitivity, and specificity. J Med Entomol. 2008;45:139–47. DOIPubMedGoogle Scholar

Main Article

Page created: December 14, 2010
Page updated: December 14, 2010
Page reviewed: December 14, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external