Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 16, Number 3—March 2010

Research

Borrelia, Ehrlichia, and Rickettsia spp. in Ticks Removed from Persons, Texas, USA

Phillip C. WilliamsonComments to Author , Peggy M. Billingsley, Glenna J. Teltow, Janel P. Seals, Meredith A. Turnbough, and Samuel F. Atkinson
Author affiliations: University of North Texas Health Science Center, Fort Worth, Texas, USA (P.C. Williamson, P.M. Billingsley, J.P. Seals); Texas Department of State Health Services, Temple, Texas, USA (G.J. Teltow); University of North Texas, Denton, Texas, USA (M.A. Turnbough, S.F. Atkinson)

Main Article

Table 1

Nucleotide sequence of primers used for PCR screening of tick specimens removed from humans, Texas, October 1, 2004, to September 30, 2008*

Primer name
Gene
Primer sequence (5′ → 3′)
Specificity
Screen
TM
Reference
Tick DNA
85F 12S TTAAGCTTTTCAGAGGAATTTGCTC Unknown Primary 54.0 This study
225R 12S TTTWWGCTGCACCTTGACTTAA Unknown Primary 52.7 This study
Borrelia spp.
FlaLL flaB ACATATTCAGATGCAGACAGAGGT Genus Primary 58.3 (4)
FlaRL flaB GCAATCATAGCCATTGCAGATTGT Genus Primary 58.9 (4)
FlaLS flaB AACAGCTGAAGAGCTTGGAATG Genus Primary 57.5 (4)
FlaRS flaB CTTTGATCACTTATCATTCTAATAGC Genus Primary 53.3 (4)
BL-Fla 522F flaB GGTACATATTCAGATGCAGACAGAGGG B. lonestari Primary 61.3 This study
BL-Fla 1182R flaB GCACTTGATTTGCTTGTGCAATCATAGCC B. lonestari Primary 64.0 This study
BL-Fla 662F flaB CTGAAGAGCTTGGAATGCAACCTGC B. lonestari Primary 62.8 This study
BL-Fla 860R flaB GAGCTAATCCCACCTTGAGCTGG B. lonestari Primary 61.2 This study
BL-Fla 341F flaB AGCTGATGATGCTGCTGGTATGGG Genus Alternate 63.2 This study
BL-Fla 730R flaB GCTTGTGCTCCAGTTAGTGATGCTGG Genus Alternate 64.1 This study
BL-16S 227F 16S TCACACTGGAACTGAGATACGGTCC Genus Alternate 62.1 This study
BL-16S 920R 16S GAATTAAACCACATGCTCCACCGC Genus Alternate 61.0 This study
BL-HSP 71F groEL CTTATGTTGAAGGAATGCAATTTGA B. lonestari Alternate 55.6 This study
BL-HSP 271R
groEL
CAATATCTTCAGCAATAATTAGCAAAGGT
B. lonestari
Alternate
58.2
This study
Rickettsia spp.
Rr.190 70P rompA ATGGCGAATATTTCTCCAAAA Genus Primary 52.5 (5)
Rr.190 602N rompA AGTGCAGCATTCGCTCCCCCT Genus Primary 64.9 (5)
BG1–21 rompB GGCAATTAATATCGCTGACGG Genus Alternate 55.6 (6)
BG2–20 rompB GCATCTGCACTAGCACTTTC Genus Alternate 55.2 (6)
RrCS 372 gltA TTTGTAGCTCTTCTCATCCTATGGC Genus Alternate 59.0 (7)
RrCS 989 gltA CCCAAGTTCCTTTAATACTTCTTTGC Genus Alternate 57.5 (7)
Primer 1 17kDa GCTCTTGCAACTTCTATGTT Genus Alternate 52.3 (8)
Primer 2
17kDa
CATTGTTCGTCAGGTTGGCG
Genus
Alternate
57.9
(8)
Ehrlichia spp.
Ehr DSB 330F dsb GATGATGTCTGAAGATATGAAACAAAT Genus Primary 55.5 (9)
Ehr DSB 728R dsb CTGCTCGTCTATTTTACTTCTTAAAGT Genus Primary 56.6 (9)
ECC-F 16S AGAACGAACGCTGGCGGCAAGCC Genus Alternate 68.1 (10)
ECB-R 16S CGTATTACCGCGGCTGCTGGCA Genus Alternate 65.6 (10)
ECAN-F 16S ATTTATAGCCTCTGGCTATAGGA E. canis Alternate 54.9 (11)
HE1-F 16S CAATTGCTTATAACCTTTTGGTTATAAAT E. chaffeensis Alternate 55.6 (12)
EE72-F 16S AATTCCTAAATAGTCTCTGACTATT E. ewingii Alternate 52.6 (11)
HE3-R 16S TATAGGTACCGTCATTATCTTCCCTAT Genus Alternate 57.6 (13)

*TM, melting temperature, °C.

Main Article

References
  1. United States Department of Agriculture. Ticks of veterinary importance. Agriculture Handbook no. 485. Rockville (MD): The Department; 1976. p. 21–35.
  2. Cooley  RA, Kohls  GM. The genus Ixodes in North America. Washington: US Government Printing Office; 1945. p. 7–11.
  3. Keirans  JE, Litwak  TR. Pictorial key to the adults of hard ticks, family Ixodidae (Ixodida: Ixodoidea), east of the Mississippi River. J Med Entomol. 1989;26:435–48.PubMedGoogle Scholar
  4. Barbour  AG, Maupin  GO, Teltow  GJ, Carter  CJ, Piesman  J. Identification of an uncultivable Borrelia species in the hard tick Amblyomma americanum: possible agent of a Lyme disease-like illness. J Infect Dis. 1996;173:403–9.PubMedGoogle Scholar
  5. Regnery  RL, Spruill  CL, Plikaytis  BD. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J Bacteriol. 1991;173:1576–89.PubMedGoogle Scholar
  6. Eremeeva  M, Yu  X, Raoult  D. Differentiation among spotted fever group rickettsiae species by analysis of restriction fragment length polymorphism of PCR-amplified DNA. J Clin Microbiol. 1994;32:803–10.PubMedGoogle Scholar
  7. Kollars  TM Jr, Kengluecha  A. Spotted fever group Rickettsia in Dermacentor variabilis (Acari: Ixodidae) infesting raccoons (Carnivora: Procyonidae) and opossums (Marsupialia: Didelphimorphidae) in Tennessee. J Med Entomol. 2001;38:601–2. DOIPubMedGoogle Scholar
  8. Webb  L, Carl  M, Malloy  DC, Dasch  GA, Azad  AF. Detection of murine typhus infection in fleas by using the polymerase chain reaction. J Clin Microbiol. 1990;28:530–4.PubMedGoogle Scholar
  9. Doyle  CK, Labruna  MB, Breitschwerdt  EB, Tang  YW, Corstvet  RE, Hegarty  BC, Detection of medically important Ehrlichia by quantitative multicolor TaqMan real-time polymerase chain reaction of the dsb gene. J Mol Diagn. 2005;7:504–10.PubMedGoogle Scholar
  10. Dawson  JE, Stallknecht  DE, Howerth  EW, Warner  C, Biggie  K, Davidson  WR, Susceptibility of white-tailed deer (Odocoileus virginianus) to infection with Ehrlichia chaffeensis, the etiologic agent of human ehrlichiosis. J Clin Microbiol. 1994;32:2725–8.PubMedGoogle Scholar
  11. Dawson  JE, Biggie  KL, Warner  CK, Cookson  K, Jenkins  S, Levine  JF, Polymerase chain reaction evidence of Ehrlichia chaffeensis, an etiologic agent of human ehrlichiosis, in dogs from southeast Virginia. Am J Vet Res. 1996;57:1175–9.PubMedGoogle Scholar
  12. Anderson  BE, Sumner  JW, Dawson  JE, Tzianabos  T, Greene  CR, Olson  JG, Detection of the etiologic agent of human ehrlichiosis by polymerase chain reaction. J Clin Microbiol. 1992;30:775–80.PubMedGoogle Scholar
  13. Long  SW, Pound  JM, Yu  XJ. Ehrlichia prevalence in Amblyomma americanum, central Texas. Emerg Infect Dis. 2004;10:1342–3.PubMedGoogle Scholar
  14. Billings  AN, Teltow  GJ, Weaver  SC, Walker  DH. Molecular characterization of a novel Rickettsia species from Ixodes scapularis in Texas. Emerg Infect Dis. 1998;4:305–9. DOIPubMedGoogle Scholar
  15. Weller  SJ, Baldridge  GD, Munderloh  UG, Noda  H, Simser  J, Kurtti  TJ. Phylogenetic placement of rickettsiae from the ticks Amblyomma americanum and Ixodes scapularis. J Clin Microbiol. 1998;36:1305–17.PubMedGoogle Scholar
  16. Roux  V, Fournier  PE, Raoult  D. Differentiation of spotted fever group rickettsiae by sequencing and analysis of restriction fragment length polymorphism of PCR-amplified DNA of the gene encoding the protein rOmpA. J Clin Microbiol. 1996;34:2058–65.PubMedGoogle Scholar
  17. Silveira  I, Pacheco  RC, Szabo  MP, Ramos  HG, Labruna  MB. Rickettsia parkeri in Brazil. Emerg Infect Dis. 2007;13:1111–3.PubMedGoogle Scholar
  18. Wikswo  ME, Hu  R, Dasch  GA, Krueger  L, Arugay  A, Jones  K, Detection and identification of spotted fever group rickettsiae in Dermacentor species from southern California. J Med Entomol. 2008;45:509–16. DOIPubMedGoogle Scholar
  19. Moore  VA IV, Varela  AS, Yabsley  MJ, Davidson  WR, Little  SE. Detection of Borrelia lonestari, putative agent of southern tick-associated rash illness, in white-tailed deer (Odocoileus virginianus) from the southeastern United States. J Clin Microbiol. 2003;41:424–7. DOIPubMedGoogle Scholar
  20. Lin  T, Gao  L, Seyfang  A, Oliver  JH Jr. ‘Candidatus Borrelia texasensis’ from the American dog tick Dermacentor variabilis. Int J Syst Evol Microbiol. 2005;55:685–93. DOIPubMedGoogle Scholar
  21. Gill  JS, Ullmann  AJ, Loftis  AD, Schwan  TG, Raffel  SJ, Schrumpf  ME, Novel relapsing fever spirochete in bat tick. Emerg Infect Dis. 2008;14:522–3. DOIPubMedGoogle Scholar
  22. Lin  T, Oliver  JH Jr, Gao  L. Comparative analysis of Borrelia isolates from southeastern USA based on randomly amplified polymorphic DNA fingerprint and 16S ribosomal gene sequence analyses. FEMS Microbiol Lett. 2003;228:249–57. DOIPubMedGoogle Scholar
  23. Fraser  CM, Casjens  S, Huang  WM, Sutton  GG, Clayton  R, Lathigra  R, Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi. Nature. 1997;390:580–6. DOIPubMedGoogle Scholar
  24. Hotopp  JC, Lin  M, Madupu  R, Crabtree  J, Angiuoli  SV, Eisen  JA, Comparative genomics of emerging human ehrlichiosis agents. PLoS Genet. 2006;2:e21. DOIPubMedGoogle Scholar
  25. Labruna  MB, McBride  JW, Camargo  LM, Aguiar  DM, Yabsley  MJ, Davidson  WR, A preliminary investigation of Ehrlichia species in ticks, humans, dogs, and capybaras from Brazil. Vet Parasitol. 2007;143:189–95. DOIPubMedGoogle Scholar
  26. McBride  JW, Ndip  LM, Popov  VL, Walker  DH. Identification and functional analysis of an immunoreactive DsbA-like thio-disulfide oxidoreductase of Ehrlichia spp. Infect Immun. 2002;70:2700–3. DOIPubMedGoogle Scholar
  27. Taylor  JP, Tanner  WB, Rawlings  JA, Buck  J, Elliott  LB, Dewlett  HJ, Serological evidence of subclinical Rocky Mountain spotted fever infections in Texas. J Infect Dis. 1985;151:367–9.PubMedGoogle Scholar
  28. Arguin  PM, Singleton  J, Rotz  LD, Marston  E, Treadwell  TA, Slater  K, An investigation into the possibility of transmission of tick-borne pathogens via blood transfusion. Transfusion-associated Tick-borne Illness Task Force. Transfusion. 1999;39:828–33. DOIPubMedGoogle Scholar
  29. McQuiston  JH, Childs  JE, Chamberland  ME, Tabor  E. Transmission of tick-borne agents of disease by blood transfusion: a review of known and potential risks in the United States. Transfusion. 2000;40:274–84. DOIPubMedGoogle Scholar
  30. Stromdahl  EY, Williamson  PC, Kollars  TM Jr, Evans  SR, Barry  RK, Vince  MA, Evidence of Borrelia lonestari DNA in Amblyomma americanum (Acari: Ixodidae) removed from humans. J Clin Microbiol. 2003;41:5557–62. DOIPubMedGoogle Scholar
  31. Taft  SC, Miller  MK, Wright  SM. Distribution of borreliae among ticks collected from eastern states. Vector Borne Zoonotic Dis. 2005;5:383–9. DOIPubMedGoogle Scholar
  32. Mixson  TR, Campbell  SR, Gill  JS, Ginsberg  HS, Reichard  MV, Schulze  TL, Prevalence of Ehrlichia, Borrelia, and rickettsial agents in Amblyomma americanum (Acari: Ixodidae) collected from nine states. J Med Entomol. 2006;43:1261–8. DOIPubMedGoogle Scholar
  33. Mahan  SM, Peter  TF, Simbi  BH, Kocan  K, Camus  E, Barbet  AF, Comparison of efficacy of American and African Amblyomma ticks as vectors of heartwater (Cowdria ruminantium) infection by molecular analyses and transmission trials. J Parasitol. 2000;86:44–9.PubMedGoogle Scholar
  34. de Lemos  ER, Machado  RD, Coura  JR, Guimaraes  MA, Freire  NM, Amorim  M, Epidemiological aspects of the Brazilian spotted fever: seasonal activity of ticks collected in an endemic area in São Paulo, Brazil. Rev Soc Bras Med Trop. 1997;30:181–5.PubMedGoogle Scholar
  35. Ripoll  CM, Remondegui  CE, Ordonez  G, Arazamendi  R, Fusaro  H, Hyman  MJ, Evidence of rickettsial spotted fever and ehrlichial infections in a subtropical territory of Jujuy, Argentina. Am J Trop Med Hyg. 1999;61:350–4.PubMedGoogle Scholar

Main Article

Page created: December 14, 2010
Page updated: December 14, 2010
Page reviewed: December 14, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external