Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 16, Number 4—April 2010
Dispatch

Hypervirulent Clostridium difficile Strains in Hospitalized Patients, Canada1

Michael R. MulveyComments to Author , David A. Boyd, Denise Gravel, Jim Hutchinson, Sharon Kelly, Allison McGeer, Dorothy Moore, Andrew Simor, Kathryn N. Suh, Geoff Taylor, J. Scott Weese, Mark A. Miller, and the Canadian Nosocomial Infection Surveillance Program
Author affiliations: Public Health Agency of Canada, Winnipeg, Manitoba, Canada (M.R. Mulvey, D.A. Boyd); Public Health Agency of Canada, Ottawa, Ontario, Canada (D. Gravel); Health Sciences Centre, St. John’s, Newfoundland and Labrador, Canada (J. Hutchinson and S. Kelly); Mount Sinai Hospital, Toronto, Ontario, Canada (A. McGeer); Montreal Children's Hospital, Montreal, Quebec, Canada (D. Moore); Sunnybrook Health Science Centre, Toronto (A. Simor); The Ottawa Hospital, Ottawa (K.N. Suh); University of Alberta Hospital, Edmonton, Alberta, Canada (G. Taylor); University of Guelph, Geulph, Ontario, Canada (J.S. Weese); and Jewish General Hospital, Montreal (M. Miller)

Main Article

Table 1

Primers used in study of hospitalized patients with Clostridium difficile infection, Canada, 2004–2008

Primer Sequence (5′ → 3′) Specificity
tcd3 TGCAATTATAAAAACATCTTTAAAC tcdC PaLoc negative regulator
tcd4 TATATCTAATAAAAGGGAGATTG
cdtB-F1 TGGACAGGAAGAATAATTCCTTC cdtB binary toxin subunit B
cdtB-R1 TGCAACTAACGGATCTCTTGC
E5 CTCAAAACTTTTTAACGAGTG ermB erythromycin/clindamycin resistance
E6 CCTCCCGTTAAATAATAGATA
GyrAF TTGAAATAGCGGAAGAAATGA gyrA DNA gyrase subunit A
GyrAR TTGCAGCTGTAGGGAAATC
GyrBF GAAGGTCAAACTAAAACAAA gyrB DNA gyrase subunit B
GyrBR GGGCTCCATCTACATCG

Main Article

1Parts of this study were presented at the 48th Interscience Conference on Antimicrobial Agents and Chemotherapy/46th Infectious Disease Society of America meeting in Washington DC, USA, October 25–28, 2008.

2Members of the Canadian Nosocomial Infection Surveillance Program who contributed data are listed at the end of this article.

Members of the Canadian Nosocomial Infection Surveillance Program who participated in the surveillance for C. difficile infection: Elizabeth Bryce, Vancouver General Hospital, Vancouver, British Columbia; John Conly, Foothills Medical Centre, Calgary, Alberta; John Embil, Health Sciences Centre, Winnipeg, Manitoba; Joanne Embree, Health Sciences Centre, Winnipeg; Sarah Forgie, Stollery Children’s Hospital, Edmonton, Alberta; Charles Frenette, McGill University Health Centre, Montreal, Quebec; Camille Lemieux, University Health Network, Toronto, Ontario; Elizabeth Henderson, Peter Lougheed Centre, Calgary; Michael John, London Health Sciences Centre, London, Ontario; Lynn Johnston, QEII Elizabeth Health Sciences Centre, Halifax, Nova Scotia; Pamela Kibsey, Victoria General Hospital, Victoria, British Columbia; Joanne Langley, IWK Health Centre, Halifax; Mark Loeb, Hamilton Health Sciences Corporation, Hamilton, Ontario; Anne Matlow, Hospital for Sick Children, Toronto; Sophie Michaud, CHUS-Hôpital Fleurimont, Sherbrooke, Quebec; Marianne Ofner, Centre for Communicable Diseases and Infection Control, Public Health Agency of Canada, Ottawa, Ontario; Virginia Roth, The Ottawa Hospital, Ottawa; Eva Thomas, Children’s and Women’s Health Center, Vancouver; William Thompson, South East Regional Health Authority, Moncton, New Brunswick; Nathalie Turgeon, Hôtel-Dieu de Québec du CHUQ, Quebec, Quebec; Mary Vearncombe, Sunnybrook Health Sciences Centre, Toronto; Karl Weiss, Maisonneuve-Rosemont Hospital, Montreal; Alice Wong, Royal University Hospital, Saskatoon, Saskatchewan; Dick Zoutman, Kingston General Hospital, Kingston, Ontario.

Page created: December 28, 2010
Page updated: December 28, 2010
Page reviewed: December 28, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external