Volume 11, Number 3—March 2005
Dispatch
Identifying Relapsing Fever Borrelia, Senegal
Table
Primers used for amplification of the Borrelia 16S ribosomal RNA gene based on GenBank accession no. M88329 for Crocidurae
| Primer (reference) | Sequence | Tm, °C* | Nucleotide position |
|---|---|---|---|
| Fd3 (4) | AGAGTTTGATCCTGGCTTAG | 58 | 8–27 |
| T50 (4) | GTTACGACTTCACCCCCCT | 60 | 1478–1499 |
| Rec4 (4) | ATGCTAGAAACTGCATGA | 50 | 659–675 |
| Rec9 (4) | TCGTCTGAGTCCCCATCT | 56 | 1191–1174 |
| Fd4 | GGCTTAGAACTAACGCTGGCAG | 68 | 21–42 |
| 595R | CTTGCATATCCGCCTACTCA | 60 | 621–602 |
| 500R (4) | CTGCTGGCACGTAATTAGCC | 64 | 548–529 |
| BcroF | CGTCTTAAGCATGCAAGTCAG | 62 | 45–65 (U42283) |
| BdutF | CGTCTTAAGCATGCAAGTCAA | 60 | 45–65 (AF107364) |
| BrecF | GAAAGGAAGCCTTTAAAGCTTT | 60 | 193–214 (AF10362) |
| 255R |
CCCTACCAACTAGCTAATAAGACGC |
74 |
255–231 |
| *Tm, melting temperature. | |||
Page created: April 25, 2012
Page updated: April 25, 2012
Page reviewed: April 25, 2012
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.