Volume 12, Number 11—November 2006
Dispatch
Human Parainfluenza Type 4 Infections, Canada
Table 1
Cell lines used for viral culture and primers used for HPIV-4 PCR testing
Cell lines | Oligonucleotide sequences (5´–3´) | Target genes |
---|---|---|
Mink lung | ATGGGTGTCAAAGGTTTATC | Fusion |
Human foreskin fibroblast | (forward) | |
Human lung carcinoma (A-549) | ||
Vero | AATTATGCAGATTGTAACTGTC | |
Hep-2 | (reverse) | |
Human rhabdomyosarcoma (RD) | ATGGTGAAAAGAACATGGAG | Hemagglutinin-neuraminidase |
Transformed human kidney 293 | (forward) | |
Human colon adenocarcinoma (HT-29) | TGGAGTATCCAGCAGTAAGA | |
Madin-Darby canine kidney (MDCK) | (reverse) | |
Tertiary monkey kidney (LLC-MK2) |
Page created: October 14, 2011
Page updated: October 14, 2011
Page reviewed: October 14, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.