Volume 12, Number 3—March 2006
Dispatch
Molecular Analysis of Fluoroquinolone-resistant Salmonella Paratyphi A Isolate, India
Table 1
Primer sequences for amplification of topoisomerases
| Primer | Sequence 5´–3´ | Amplicon | Gene (coding sequence length) |
|---|---|---|---|
| gyrA7 (F) | 5´ GGGTCGACTGATTATGGTTTATGCCTCC 3´ | 3199 | 2637 |
| gyrA25 (R) | 5´ GAGACTTTCAGCGTAGTTCG 3´ | ||
| gyrB1 (F) | 5´ TTGCCTCTGAACTTGACGATGC 3´ | 2762 | 2415 |
| gyrB9 (R) | 5´ GAAGTCGCTGACCTGCTCAC 3´ | ||
| parC3 (F) | 5´ CGATTTTCCGGTCTTCTTCCAG 3´ | 2616 | 2259 |
| parC10 (R) | 5´ GCAATGCACGAATAAACAACGG 3´ | ||
| parE3 (F) | 5´ CCTGATCTGGCTACTGCAACAG 3´ | 2183 | 1893 |
| parE8 (R) | 5´ ATGCGCAAGTGTCGCCATCAG 3´ |
Page created: January 27, 2012
Page updated: January 27, 2012
Page reviewed: January 27, 2012
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.