Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 12, Number 4—April 2006
Research

Lineage 1 and 2 Strains of Encephalitic West Nile Virus, Central Europe

Tamás Bakonyi*†, Éva Ivanics‡, Károly Erdélyi‡, Krisztina Ursu‡, Emőke Ferenczi§, Herbert Weissenböck*, and Norbert Nowotny*¶Comments to Author 
Author affiliations: *University of Veterinary Medicine, Vienna, Austria; †Szent István University, Budapest, Hungary; ‡Central Veterinary Institute, Budapest, Hungary; §"Béla Johan" National Center for Epidemiology, Budapest, Hungary; ¶United Arab Emirates University, Al Ain, United Arab Emirates

Main Article

Table A2

Oligonucleotide primers used for sequencing of West Nile virus (WNV) strain goshawk-Hungary/04

Name* Sequence 5´ to 3´ Product length (bp)
WNVII 1f AGTAGTTCGCCTGTGTGAGC 200
WNVII 200r AGCATAGCCCTCTTCAGTCC
WNVII 81f TGGCACGAAGATCTCGATGT 874
WNVII 954r TGCCACCAGGAGCAATAGAA
WNVII 870f CCTCGTTGCAGCTGTCATTG 761
WNVII 1630r TCCATGGCAGGTTCAGATCC
WNVII 1584f CTTCCTGGTTCACCGAGAAT 908
WNVII 2491r CTTGCCTGCCAATGTCAATG
Usu 2328f CTCTTTGGRGGRATGTCHTG 818
Usu 3145r GTGCADGATTTKACYTCTCC
WNVII 3027f CAACATGGCTGTGCATAGTG 673
WNVII 3699r GCCGACGAGAATGACATATC
Usu 3606f AAGAGGTGGACGGCCARRHT 1,152
Usu 4759r GTGTGCCAYAGYGTGTGGAA
WNVII 3861f GGCTTACTATGACGCCAAGA 594
WNVII 4454r CCATCATCATCCAGCCTAAC
Usu 4251f ATGTTYGCCATYGTWGGDGG 1,142
Usu 5392r TGGCACATSACATCMACKAT
WNVII 5294f TTGCTGCTGAGATGTCTGAG 324
WNVII 5617r TGTCCGAGATAGGAGCATTG
Usu 5454f ATGGATGAAGCYCATTTCAC 337
Usu 5790r GGTAYTCYGTMTCATAGGAC
WNVII 5629f GCCTGGAACACTGGATATGA 616
WNVII 6245r TAAGCGAGCCAGACTGGTAA
WNVII 6127f TATCAGCCTGAGCGCGAGAA 932
WNVII 7058r ACGGCTGTCGTTACGGCATA
WNVII 6935f ATGACATTGGCAGCCTGTTG 672
WNVII 7606r ATCCTCCTCGCATGATGTGA
WNVII 7505f GAGAGGCTGGAATTCTGACT 653
WNVII 8158r GTTCTTCTACCTCGGCACTT
WNV 8078f CATCAGAAGCGAGCGACACA 744
WNV 8821r ACAGCCAGTTCGTGGTCTCA
WNV 8723f TCGGTCAACAACGAGTGTTC 739
WNV 9461r GAGATGACGTCCATCACAGT
WNV 9368f TAGCGCGGTCCATCATCGAG 733
WNV 10100r CCAACGTTCGACCGGAGTCT
WNVII 10023f CTGTTCCGCTGTGCCTGTCA 519
WNVII 10541r CGTGGATCACCTCGCAGCTT
WNV 9031f TACAACATGATGGGVAARAGAGAGA 1,061
WNV 10091r AGCATGTCTTCYGTBGTCATCCAYT
WNV 10460f GCCACCGGAAGTTGAGTAGA 430
WNV 10889r GCTGGTTGTGCAGAGCAGAA
Usu 10596f GWAAGCCTCYCAGAACCGTCTCGGAAG 419
Usu 11014r AGATCCTGTGKTCTWSYYCMCCAYCAG

*Numbers refer to nucleic acid positions at the 5´-end, according to the complete genomic sequence of the closely related lineage 2 WNV strain B956 (NC_001563). Universal, Japanese encephalitis virus–group specific primers are indicated in italics (28). f, forward (genomic) primer; r, reverse (complementary) primer. Usu, Usutu.

Main Article

References
  1. Smithburn  KC, Hughes  TP, Burke  AW, Paul  JH. A neurotropic virus isolated from the blood of a native of Uganda. Am J Trop Med Hyg. 1940;20:471.
  2. Peiris  JSM, Amerasinghe  FP. West Nile fever. In: Beran GW, Steele JH, editors. Handbook of zoonoses. Section B: Viral. 2nd ed. Boca Raton (FL): CRC Press; 1994. p. 139–48.
  3. Hubálek  Z, Halouzka  J. West Nile fever—a reemerging mosquito-borne viral disease in Europe. Emerg Infect Dis. 1999;5:64350. DOIPubMed
  4. Anderson  JF, Andreadis  TG, Vossbrink  CR, Tirrell  S, Wakem  EM, French  RA, Isolation of West Nile virus from mosquitoes, crows, and a Cooper's hawk in Connecticut. Science. 1999;286:23313. DOIPubMed
  5. Blitvich  BJ, Fernandez-Salas  I, Contreras-Cordero  JF, Marlenee  NL, Gonzalez-Rojas  JI, Komar  N, Serologic evidence of West Nile virus infection in horses, Coahuila State, Mexico. Emerg Infect Dis. 2003;9:8536.PubMed
  6. Glaser  A. West Nile virus and North America: an unfolding story. Rev Sci Tech. 2004;23:55768.PubMed
  7. Spielman  A, Andreadis  TG, Apperson  CS, Cornel  AJ, Day  JF, Edman  JD, Outbreak of West Nile virus in North America. Science. 2004;306:14735. DOIPubMed
  8. Zeller  HG, Schuffenecker  I. West Nile virus: an overview of its spread in Europe and the Mediterranean basin in contrast to its spread in the Americas. Eur J Clin Microbiol Infect Dis. 2004;23:14756. DOIPubMed
  9. Van der Meulen  KM, Pensaert  MB, Nauwynck  HJ. West Nile virus in the vertebrate world. Arch Virol. 2005;150:63757. DOIPubMed
  10. Campbell  GL, Marfin  AA, Lanciotti  RS, Gubler  DJ. West Nile virus. Lancet Infect Dis. 2002;2:51929. DOIPubMed
  11. Lanciotti  RS, Roehrig  JT, Deubel  V, Smith  J, Parker  M, Steele  K, Origin of the West Nile virus responsible for an outbreak of encephalitis in the northeastern United States. Science. 1999;286:23337. DOIPubMed
  12. Giladi  M, Metzkor-Cotter  E, Martin  DA, Siegman-Igra  Y, Korczyn  AD, Rosso  R, West Nile encephalitis in Israel, 1999: the New York connection. Emerg Infect Dis. 2001;7:6548. DOIPubMed
  13. Banet-Noach  C, Malkinson  M, Brill  A, Samina  I, Yadin  H, Weisman  Y, Phylogenetic relationships of West Nile viruses isolated from birds and horses in Israel from 1997 to 2001. Virus Genes. 2003;26:13541. DOIPubMed
  14. Beasley  DW, Li  L, Suderman  MT, Barrett  AD. Mouse neuroinvasive phenotype of West Nile virus strains varies depending upon virus genotype. Virology. 2002;296:1723. DOIPubMed
  15. Berthet  FX, Zeller  HG, Drouet  MT, Rauzier  J, Digoutte  JP, Deubel  V. Extensive nucleotide changes and deletions within the envelope glycoprotein gene of Euro-African West Nile viruses. J Gen Virol. 1997;78:22937.PubMed
  16. Lanciotti  RS, Ebel  GD, Deubel  V, Kerst  AJ, Murri  S, Meyer  R, Complete genome sequences and phylogenetic analysis of West Nile virus strains isolated from the United States, Europe, and the Middle East. Virology. 2002;298:96105. DOIPubMed
  17. Charrel  RN, Brault  AC, Gallian  P, Lemasson  JJ, Murgue  B, Murri  S, Evolutionary relationship between Old World West Nile virus strains. Evidence for viral gene flow between Africa, the Middle East, and Europe. Virology. 2003;315:3818. DOIPubMed
  18. Bakonyi  T, Hubalek  Z, Rudolf  I, Nowotny  N. Novel flavivirus or new lineage of West Nile virus, central Europe. Emerg Infect Dis. 2005;11:22531.PubMed
  19. Glávits  R, Ferenczi  E, Ivanics  É, Bakonyi  T, Mató  T, Zarka  P, Occurrence of West Nile Fever in a circovirus infected goose flock in Hungary. Avian Pathol. 2005;34:40814. DOIPubMed
  20. Ferenczi  E, Rácz  G, Faludi  G, Czeglédi  A, Mezey  I, Berencsi  G. Natural foci of classical and emerging viral zoonoses in Hungary. In: Berencsi G, Khan AS, Halouzka J, editors. Emerging biological threat. Amsterdam: IOS Press; 2005. p. 43–9.
  21. Weissenböck  H, Kolodziejek  J, Url  A, Lussy  H, Rebel-Bauder  B, Nowotny  N. Emergence of Usutu virus, an African mosquito-borne flavivirus of the Japanese encephalitis virus group, central Europe. Emerg Infect Dis. 2002;8:6526.PubMed
  22. Thompson  JD, Gibson  TJ, Plewniak  F, Jeanmougin  F, Higgins  DG. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997;25:487682. DOIPubMed
  23. Malkinson  M, Banet  C, Weisman  Y, Pokamunski  S, King  R, Drouet  MT, Introduction of West Nile virus in the Middle East by migrating white storks. Emerg Infect Dis. 2002;8:3927. DOIPubMed
  24. Lvov  DK, Butenko  AM, Gromashevsky  VL, Kovtunov  AI, Prilipov  AG, Kinney  R, West Nile virus and other zoonotic viruses in Russia: examples of emerging-reemerging situations. Arch Virol Suppl. 2004;18:8596.PubMed
  25. Bakonyi  T, Gould  EA, Kolodziejek  J, Weissenböck  H, Nowotny  N. Complete genome analysis and molecular characterization of Usutu virus that emerged in Austria in 2001: comparison with the South African strain SAAR-1776 and other flaviviruses. Virology. 2004;328:30110. DOIPubMed
  26. Weissenböck  H, Kolodziejek  J, Fragner  K, Kuhn  R, Pfeffer  M, Nowotny  N. Usutu virus activity in Austria, 2001–2002. Microbes Infect. 2003;5:11326. DOIPubMed
  27. Lanciotti  RS, Ebel  GD, Deubel  V, Kerst  AJ, Murri  S, Meyer  R, Complete genome sequences and phylogenetic analysis of West Nile virus strains isolated from the United States, Europe, and the Middle East. Virology. 2002;298:96105. DOIPubMed
  28. Bakonyi  T, Gould  EA, Kolodziejek  J, Weissenbock  H, Nowotny  N. Complete genome analysis and molecular characterization of Usutu virus that emerged in Austria in 2001: comparison with the South African strain SAAR-1776 and other flaviviruses. Virology. 2004;328:30110. DOIPubMed

Main Article

Page created: January 24, 2012
Page updated: January 24, 2012
Page reviewed: January 24, 2012
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external