Volume 12, Number 9—September 2006
Research
Predominance of Ancestral Lineages of Mycobacterium tuberculosis in India
Table 3
Conditions for multiplex PCRs of 9 VNTR loci*
| Multiplex | Locus | Conventional designation† | VNTR length (bp) | MgCl2 (mmol) | PCR primer pairs (5´ to 3´, with labeling indicated) |
|---|---|---|---|---|---|
| Mix E | 46 | VNTR 2347 | 57 | 1.5 | GCCAGCCGCCGTGCATAAACCT (Fam) AGCCACCCGGTGTGCCTTGTATGAC |
| 48 | VNTR 2461 | 57 | ATGGCCACCCGATACCGCTTCAGT (Vic) CGACGGGCCATCTTGGATCAGCTAC | ||
| 49 | VNTR 3171 | 54 | GGTGCGCACCTGCTCCAGATAA (Ned) GGCTCTCATTGCTGGAGGGTTGTAC | ||
| Mix F | 42 | VNTR 0424 | 51 | 1.5 | CTTGGCCGGCATCAAGCGCATTATT GGCAGCAGAGCCCGGGATTCTTC (Fam) |
| 43 | VNTR 0577 | 58 | CGAGAGTGGCAGTGGCGGTTATCT (Vic) AATGACTTGAACGCGCAAATTGTGA | ||
| 44 | VNTR 1895 | 57 | GTGAGCAGGCCCAGCAGACT (Ned) CCACGAAATGTTCAAACACCTCAAT | ||
| Mix G | 47 | VNTR 2401 | 58 | 3.0 | CTTGAAGCCCCGGTCTCATCTGT (Fam) ACTTGAACCCCCACGCCCATTAGTA |
| 52 | VNTR 3690 | 58 | CGGTGGAGGCGATGAACGTCTTC (Vic) TAGAGCGGCACGGGGGAAAGCTTAG | ||
| 53 | VNTR 4156 | 59 | TGACCACGGATTGCTCTAGT GCCGGCGTCCATGTT (Ned) |
References
- World Health Organization. Global tuberculosis control: surveillance, planning, financing (WH/HTM/TB/2004.331). Geneva: The Organization; 2004.
- Sreevatsan S, Pan X, Stockbauer KE, Connell ND, Kreiswirth BN, Whittam TS, Restricted structural gene polymorphism in the Mycobacterium tuberculosis complex indicates evolutionarily recent global dissemination. Proc Natl Acad Sci U S A. 1997;94:9869–74. DOIPubMedGoogle Scholar
- Gutacker MM, Smoot JC, Migliaccio CA, Ricklefs SM, Hua S, Cousins DV, Genome-wide analysis of synonymous single nucleotide polymorphisms in Mycobacterium tuberculosis complex organisms: resolution of genetic relationships among closely related microbial strains. Genetics. 2002;162:1533–43.PubMedGoogle Scholar
- Supply P, Warren RM, Banuls AL, Lesjean S, Van Der Spuy GD, Lewis LA, Linkage disequilibrium between minisatellite loci supports clonal evolution of Mycobacterium tuberculosis in a high tuberculosis incidence area. Mol Microbiol. 2003;47:529–38. DOIPubMedGoogle Scholar
- Bifani PJ, Mathema B, Kurepina NE, Kreiswirth BN. Global dissemination of the Mycobacterium tuberculosis W-Beijing family strains. Trends Microbiol. 2002;10:45–52. DOIPubMedGoogle Scholar
- Hirsh AE, Tsolaki AG, DeRiemer K, Feldman MW, Small PM. Stable association between strains of Mycobacterium tuberculosis and their human host populations. Proc Natl Acad Sci U S A. 2004;101:4871–6. Epub 2004 Mar 23. DOIPubMedGoogle Scholar
- van Embden JD, Cave MD, Crawford JT, Dale JW, Eisenach KD, Gicquel B, Strain identification of Mycobacterium tuberculosis by DNA fingerprinting: recommendations for a standardized methodology. J Clin Microbiol. 1993;31:406–9.PubMedGoogle Scholar
- Das S, Paramasivan CN, Lowrie DB, Prabhakar R, Narayanan PR. IS6110 restriction fragment length polymorphism typing of clinical isolates of Mycobacterium tuberculosis from patients with pulmonary tuberculosis in Madras, south India. Tuber Lung Dis. 1995;76:550–4. DOIPubMedGoogle Scholar
- Radhakrishnan I, K MY, Kumar RA, Mundayoor S, Harris KA, Jr., Mukundan U, Implications of low frequency of IS6110 in fingerprinting field isolates of Mycobacterium tuberculosis from Kerala, India. J Clin Microbiol. 2001;39:1683. DOIPubMedGoogle Scholar
- Siddiqi N, Shamim M, Amin A, Chauhan DS, Das R, Srivastava K, Typing of drug resistant isolates of Mycobacterium tuberculosis from India using the IS6110 element reveals substantive polymorphism. Infect Genet Evol. 2001;1:109–16. DOIPubMedGoogle Scholar
- Bhanu NV, van Soolingen D, van Embden JD, Dar L, Pandey RM, Seth P. Predominance of a novel Mycobacterium tuberculosis genotype in the Delhi region of India. Tuberculosis (Edinb). 2002;82:105–12. DOIPubMedGoogle Scholar
- Braden CR, Crawford JT, Schable BA. Quality assessment of Mycobacterium tuberculosis genotyping in a large laboratory network. Emerg Infect Dis. 2002;8:1210–5.PubMedGoogle Scholar
- Narayanan S, Sahadevan R, Narayanan PR, Krishnamurthy PV, Paramasivan CN, Prabhakar R. Restriction fragment length polymorphism of Mycobacterium tuberculosis strains from various regions of India, using direct repeat probe. Indian J Med Res. 1997;106:447–54.PubMedGoogle Scholar
- Mistry NF, Iyer AM, D'Souza DT, Taylor GM, Young DB, Antia NH. Spoligotyping of Mycobacterium tuberculosis isolates from multiple-drug-resistant tuberculosis patients from Bombay, India. J Clin Microbiol. 2002;40:2677–80. DOIPubMedGoogle Scholar
- Singh UB, Suresh N, Bhanu NV, Arora J, Pant H, Sinha S, Predominant tuberculosis spoligotypes, Delhi, India. Emerg Infect Dis. 2004;10:1138–42.PubMedGoogle Scholar
- Kremer K, van Soolingen D, Frothingham R, Haas WH, Hermans PW, Martin C, Comparison of methods based on different molecular epidemiological markers for typing of Mycobacterium tuberculosis complex strains: interlaboratory study of discriminatory power and reproducibility. J Clin Microbiol. 1999;37:2607–18.PubMedGoogle Scholar
- Supply P, Magdalena J, Himpens S, Locht C. Identification of novel intergenic repetitive units in a mycobacterial two-component system operon. Mol Microbiol. 1997;26:991–1003. DOIPubMedGoogle Scholar
- Supply P, Mazars E, Lesjean S, Vincent V, Gicquel B, Locht C. Variable human minisatellite-like regions in the Mycobacterium tuberculosis genome. Mol Microbiol. 2000;36:762–71. DOIPubMedGoogle Scholar
- Supply P, Lesjean S, Savine E, Kremer K, van Soolingen D, Locht C. Automated high-throughput genotyping for study of global epidemiology of Mycobacterium tuberculosis based on mycobacterial interspersed repetitive units. J Clin Microbiol. 2001;39:3563–71. DOIPubMedGoogle Scholar
- Mazars E, Lesjean S, Banuls AL, Gilbert M, Vincent V, Gicquel B, High-resolution minisatellite-based typing as a portable approach to global analysis of Mycobacterium tuberculosis molecular epidemiology. Proc Natl Acad Sci U S A. 2001;98:1901–6. DOIPubMedGoogle Scholar
- Cowan LS, Mosher L, Diem L, Massey JP, Crawford JT. Variable-number tandem repeat typing of Mycobacterium tuberculosis isolates with low copy numbers of IS6110 by using mycobacterial interspersed repetitive units. J Clin Microbiol. 2002;40:1592–602. DOIPubMedGoogle Scholar
- Savine E, Warren RM, van der Spuy GD, Beyers N, van Helden PD, Locht C, Stability of variable-number tandem repeats of mycobacterial interspersed repetitive units from 12 loci in serial isolates of Mycobacterium tuberculosis. J Clin Microbiol. 2002;40:4561–6. DOIPubMedGoogle Scholar
- Frothingham R, Meeker-O'Connell WA. Genetic diversity in the Mycobacterium tuberculosis complex based on variable numbers of tandem DNA repeats. Microbiology. 1998;144:1189–96. DOIPubMedGoogle Scholar
- Roring S, Scott A, Brittain D, Walker I, Hewinson G, Neill S, Development of variable-number tandem repeat typing of Mycobacterium bovis: comparison of results with those obtained by using existing exact tandem repeats and spoligotyping. J Clin Microbiol. 2002;40:2126–33. DOIPubMedGoogle Scholar
- Le Fleche P, Fabre M, Denoeud F, Koeck JL, Vergnaud G. High resolution, on-line identification of strains from the Mycobacterium tuberculosis complex based on tandem repeat typing. BMC Microbiol. 2002;2:37. DOIPubMedGoogle Scholar
- Soini H, Pan X, Amin A, Graviss EA, Siddiqui A, Musser JM. Characterization of Mycobacterium tuberculosis isolates from patients in Houston, Texas, by spoligotyping. J Clin Microbiol. 2000;38:669–76.PubMedGoogle Scholar
- Sola C, Filliol I, Legrand E, Mokrousov I, Rastogi N. Mycobacterium tuberculosis phylogeny reconstruction based on combined numerical analysis with IS1081, IS6110, VNTR, and DR-based spoligotyping suggests the existence of two new phylogeographical clades. J Mol Evol. 2001;53:680–9. DOIPubMedGoogle Scholar
- Brosch R, Gordon SV, Marmiesse M, Brodin P, Buchrieser C, Eiglmeier K, A new evolutionary scenario for the Mycobacterium tuberculosis complex. Proc Natl Acad Sci U S A. 2002;99:3684–9. DOIPubMedGoogle Scholar
- Kamerbeek J, Schouls L, Kolk A, van Agterveld M, van Soolingen D, Kuijper S, Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology. J Clin Microbiol. 1997;35:907–14.PubMedGoogle Scholar
- Warren RM, Victor TC, Streicher EM, Richardson M, van der Spuy GD, Johnson R, Clonal expansion of a globally disseminated lineage of Mycobacterium tuberculosis with low IS6110 copy numbers. J Clin Microbiol. 2004;42:5774–82. DOIPubMedGoogle Scholar
- Filliol I, Driscoll JR, van Soolingen D, Kreiswirth BN, Kremer K, Valetudie G, Snapshot of moving and expanding clones of Mycobacterium tuberculosis and their global distribution assessed by spoligotyping in an international study. J Clin Microbiol. 2003;41:1963–70. DOIPubMedGoogle Scholar
- van Soolingen D, Qian L, de Haas PE, Douglas JT, Traore H, Portaels F, Predominance of a single genotype of Mycobacterium tuberculosis in countries of east Asia. J Clin Microbiol. 1995;33:3234–8.PubMedGoogle Scholar
- Filliol I, Driscoll JR, Van Soolingen D, Kreiswirth BN, Kremer K, Valetudie G, Global distribution of Mycobacterium tuberculosis spoligotypes. Emerg Infect Dis. 2002;8:1347–9.PubMedGoogle Scholar
- Sun YJ, Bellamy R, Lee AS, Ng ST, Ravindran S, Wong SY, Use of mycobacterial interspersed repetitive unit-variable-number tandem repeat typing to examine genetic diversity of Mycobacterium tuberculosis in Singapore. J Clin Microbiol. 2004;42:1986–93. DOIPubMedGoogle Scholar
- Banu S, Gordon SV, Palmer S, Islam R, Ahmed S, Alam KM, Genotypic analysis of Mycobacterium tuberculosis in Bangladesh and prevalence of the Beijing strain. J Clin Microbiol. 2004;42:674–82. DOIPubMedGoogle Scholar
- Shamputa IC, Rigouts L, Eyongeta LA, El Aila NA, van Deun A, Salim AH, Genotypic and phenotypic heterogeneity among Mycobacterium tuberculosis isolates from pulmonary tuberculosis patients. J Clin Microbiol. 2004;42:5528–36. DOIPubMedGoogle Scholar
- Dale JW, Al-Ghusein H, Al-Hashmi S, Butcher P, Dickens AL, Drobniewski F, Evolutionary relationships among strains of Mycobacterium tuberculosis with few copies of IS6110. J Bacteriol. 2003;185:2555–62. DOIPubMedGoogle Scholar
- Narayanan S, Das S, Garg R, Hari L, Rao VB, Frieden TR, Molecular epidemiology of tuberculosis in a rural area of high prevalence in South India: implications for disease control and prevention. J Clin Microbiol. 2002;40:4785–8. DOIPubMedGoogle Scholar
- Sun YJ, Lee AS, Ng ST, Ravindran S, Kremer K, Bellamy R, Characterization of ancestral Mycobacterium tuberculosis by multiple genetic markers and proposal of genotyping strategy. J Clin Microbiol. 2004;42:5058–64. DOIPubMedGoogle Scholar
- Gutierrez MC, Brisse S, Brosch R, Omais B, Marmiesse M, Supply P, Ancient origin and gene mosaicism of tubercle bacilli. PLoS Pathog. 2005;1:e5. DOIPubMedGoogle Scholar
1These authors contributed equally to this article.
Page created: November 17, 2011
Page updated: November 17, 2011
Page reviewed: November 17, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.