Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 12, Number 9—September 2006

Research

Predominance of Ancestral Lineages of Mycobacterium tuberculosis in India

M. Cristina Gutierrez*1, Niyaz Ahmed†1, Eve Willery‡, Sujatha Narayanan§, Seyed E. Hasnain†, Devendra S. Chauhan¶, Vishwa M. Katoch¶, Véronique Vincent*, Camille Locht‡, and Philip Supply‡Comments to Author 
Author affiliations: *Institut Pasteur, Paris, France; †Center for DNA Fingerprinting and Diagnostics, Hyderabad, India; ‡Institut Pasteur de Lille, Lille, France; §Tuberculosis Research Center, Chennai, India; ¶National Jalma Institute for Leprosy and Other Mycobacterial Diseases, Agra, India

Main Article

Table 3

Conditions for multiplex PCRs of 9 VNTR loci*

Multiplex Locus Conventional
designation† VNTR length (bp) MgCl2 (mmol) PCR primer pairs
(5´ to 3´, with labeling indicated)
Mix E 46 VNTR 2347 57 1.5 GCCAGCCGCCGTGCATAAACCT (Fam)
AGCCACCCGGTGTGCCTTGTATGAC
48 VNTR 2461 57 ATGGCCACCCGATACCGCTTCAGT (Vic)
CGACGGGCCATCTTGGATCAGCTAC
49 VNTR 3171 54 GGTGCGCACCTGCTCCAGATAA (Ned)
GGCTCTCATTGCTGGAGGGTTGTAC
Mix F 42 VNTR 0424 51 1.5 CTTGGCCGGCATCAAGCGCATTATT
GGCAGCAGAGCCCGGGATTCTTC (Fam)
43 VNTR 0577 58 CGAGAGTGGCAGTGGCGGTTATCT (Vic)
AATGACTTGAACGCGCAAATTGTGA
44 VNTR 1895 57 GTGAGCAGGCCCAGCAGACT (Ned)
CCACGAAATGTTCAAACACCTCAAT
Mix G 47 VNTR 2401 58 3.0 CTTGAAGCCCCGGTCTCATCTGT (Fam)
ACTTGAACCCCCACGCCCATTAGTA
52 VNTR 3690 58 CGGTGGAGGCGATGAACGTCTTC (Vic)
TAGAGCGGCACGGGGGAAAGCTTAG
53 VNTR 4156 59 TGACCACGGATTGCTCTAGT
GCCGGCGTCCATGTT (Ned)

*VNTR, variable-number tandem repeats.
†VNTR 0577, 2461, 4156, 1895 correspond to ETRC, ETRB, QUB 4156 and 1895, respectively (23,24). The conditions for PCR amplification were the same as in (30).

Main Article

References
  1. World Health Organization. Global tuberculosis control: surveillance, planning, financing (WH/HTM/TB/2004.331). Geneva: The Organization; 2004.
  2. Sreevatsan  S, Pan  X, Stockbauer  KE, Connell  ND, Kreiswirth  BN, Whittam  TS, Restricted structural gene polymorphism in the Mycobacterium tuberculosis complex indicates evolutionarily recent global dissemination. Proc Natl Acad Sci U S A. 1997;94:9869–74. DOIPubMedGoogle Scholar
  3. Gutacker  MM, Smoot  JC, Migliaccio  CA, Ricklefs  SM, Hua  S, Cousins  DV, Genome-wide analysis of synonymous single nucleotide polymorphisms in Mycobacterium tuberculosis complex organisms: resolution of genetic relationships among closely related microbial strains. Genetics. 2002;162:1533–43.PubMedGoogle Scholar
  4. Supply  P, Warren  RM, Banuls  AL, Lesjean  S, Van Der Spuy  GD, Lewis  LA, Linkage disequilibrium between minisatellite loci supports clonal evolution of Mycobacterium tuberculosis in a high tuberculosis incidence area. Mol Microbiol. 2003;47:529–38. DOIPubMedGoogle Scholar
  5. Bifani  PJ, Mathema  B, Kurepina  NE, Kreiswirth  BN. Global dissemination of the Mycobacterium tuberculosis W-Beijing family strains. Trends Microbiol. 2002;10:45–52. DOIPubMedGoogle Scholar
  6. Hirsh  AE, Tsolaki  AG, DeRiemer  K, Feldman  MW, Small  PM. Stable association between strains of Mycobacterium tuberculosis and their human host populations. Proc Natl Acad Sci U S A. 2004;101:4871–6. Epub 2004 Mar 23. DOIPubMedGoogle Scholar
  7. van Embden  JD, Cave  MD, Crawford  JT, Dale  JW, Eisenach  KD, Gicquel  B, Strain identification of Mycobacterium tuberculosis by DNA fingerprinting: recommendations for a standardized methodology. J Clin Microbiol. 1993;31:406–9.PubMedGoogle Scholar
  8. Das  S, Paramasivan  CN, Lowrie  DB, Prabhakar  R, Narayanan  PR. IS6110 restriction fragment length polymorphism typing of clinical isolates of Mycobacterium tuberculosis from patients with pulmonary tuberculosis in Madras, south India. Tuber Lung Dis. 1995;76:550–4. DOIPubMedGoogle Scholar
  9. Radhakrishnan  I, K  MY, Kumar  RA, Mundayoor  S, Harris  KA, Jr., Mukundan  U, Implications of low frequency of IS6110 in fingerprinting field isolates of Mycobacterium tuberculosis from Kerala, India. J Clin Microbiol. 2001;39:1683. DOIPubMedGoogle Scholar
  10. Siddiqi  N, Shamim  M, Amin  A, Chauhan  DS, Das  R, Srivastava  K, Typing of drug resistant isolates of Mycobacterium tuberculosis from India using the IS6110 element reveals substantive polymorphism. Infect Genet Evol. 2001;1:109–16. DOIPubMedGoogle Scholar
  11. Bhanu  NV, van Soolingen  D, van Embden  JD, Dar  L, Pandey  RM, Seth  P. Predominance of a novel Mycobacterium tuberculosis genotype in the Delhi region of India. Tuberculosis (Edinb). 2002;82:105–12. DOIPubMedGoogle Scholar
  12. Braden  CR, Crawford  JT, Schable  BA. Quality assessment of Mycobacterium tuberculosis genotyping in a large laboratory network. Emerg Infect Dis. 2002;8:1210–5.PubMedGoogle Scholar
  13. Narayanan  S, Sahadevan  R, Narayanan  PR, Krishnamurthy  PV, Paramasivan  CN, Prabhakar  R. Restriction fragment length polymorphism of Mycobacterium tuberculosis strains from various regions of India, using direct repeat probe. Indian J Med Res. 1997;106:447–54.PubMedGoogle Scholar
  14. Mistry  NF, Iyer  AM, D'Souza  DT, Taylor  GM, Young  DB, Antia  NH. Spoligotyping of Mycobacterium tuberculosis isolates from multiple-drug-resistant tuberculosis patients from Bombay, India. J Clin Microbiol. 2002;40:2677–80. DOIPubMedGoogle Scholar
  15. Singh  UB, Suresh  N, Bhanu  NV, Arora  J, Pant  H, Sinha  S, Predominant tuberculosis spoligotypes, Delhi, India. Emerg Infect Dis. 2004;10:1138–42.PubMedGoogle Scholar
  16. Kremer  K, van Soolingen  D, Frothingham  R, Haas  WH, Hermans  PW, Martin  C, Comparison of methods based on different molecular epidemiological markers for typing of Mycobacterium tuberculosis complex strains: interlaboratory study of discriminatory power and reproducibility. J Clin Microbiol. 1999;37:2607–18.PubMedGoogle Scholar
  17. Supply  P, Magdalena  J, Himpens  S, Locht  C. Identification of novel intergenic repetitive units in a mycobacterial two-component system operon. Mol Microbiol. 1997;26:991–1003. DOIPubMedGoogle Scholar
  18. Supply  P, Mazars  E, Lesjean  S, Vincent  V, Gicquel  B, Locht  C. Variable human minisatellite-like regions in the Mycobacterium tuberculosis genome. Mol Microbiol. 2000;36:762–71. DOIPubMedGoogle Scholar
  19. Supply  P, Lesjean  S, Savine  E, Kremer  K, van Soolingen  D, Locht  C. Automated high-throughput genotyping for study of global epidemiology of Mycobacterium tuberculosis based on mycobacterial interspersed repetitive units. J Clin Microbiol. 2001;39:3563–71. DOIPubMedGoogle Scholar
  20. Mazars  E, Lesjean  S, Banuls  AL, Gilbert  M, Vincent  V, Gicquel  B, High-resolution minisatellite-based typing as a portable approach to global analysis of Mycobacterium tuberculosis molecular epidemiology. Proc Natl Acad Sci U S A. 2001;98:1901–6. DOIPubMedGoogle Scholar
  21. Cowan  LS, Mosher  L, Diem  L, Massey  JP, Crawford  JT. Variable-number tandem repeat typing of Mycobacterium tuberculosis isolates with low copy numbers of IS6110 by using mycobacterial interspersed repetitive units. J Clin Microbiol. 2002;40:1592–602. DOIPubMedGoogle Scholar
  22. Savine  E, Warren  RM, van der Spuy  GD, Beyers  N, van Helden  PD, Locht  C, Stability of variable-number tandem repeats of mycobacterial interspersed repetitive units from 12 loci in serial isolates of Mycobacterium tuberculosis. J Clin Microbiol. 2002;40:4561–6. DOIPubMedGoogle Scholar
  23. Frothingham  R, Meeker-O'Connell  WA. Genetic diversity in the Mycobacterium tuberculosis complex based on variable numbers of tandem DNA repeats. Microbiology. 1998;144:1189–96. DOIPubMedGoogle Scholar
  24. Roring  S, Scott  A, Brittain  D, Walker  I, Hewinson  G, Neill  S, Development of variable-number tandem repeat typing of Mycobacterium bovis: comparison of results with those obtained by using existing exact tandem repeats and spoligotyping. J Clin Microbiol. 2002;40:2126–33. DOIPubMedGoogle Scholar
  25. Le Fleche  P, Fabre  M, Denoeud  F, Koeck  JL, Vergnaud  G. High resolution, on-line identification of strains from the Mycobacterium tuberculosis complex based on tandem repeat typing. BMC Microbiol. 2002;2:37. DOIPubMedGoogle Scholar
  26. Soini  H, Pan  X, Amin  A, Graviss  EA, Siddiqui  A, Musser  JM. Characterization of Mycobacterium tuberculosis isolates from patients in Houston, Texas, by spoligotyping. J Clin Microbiol. 2000;38:669–76.PubMedGoogle Scholar
  27. Sola  C, Filliol  I, Legrand  E, Mokrousov  I, Rastogi  N. Mycobacterium tuberculosis phylogeny reconstruction based on combined numerical analysis with IS1081, IS6110, VNTR, and DR-based spoligotyping suggests the existence of two new phylogeographical clades. J Mol Evol. 2001;53:680–9. DOIPubMedGoogle Scholar
  28. Brosch  R, Gordon  SV, Marmiesse  M, Brodin  P, Buchrieser  C, Eiglmeier  K, A new evolutionary scenario for the Mycobacterium tuberculosis complex. Proc Natl Acad Sci U S A. 2002;99:3684–9. DOIPubMedGoogle Scholar
  29. Kamerbeek  J, Schouls  L, Kolk  A, van Agterveld  M, van Soolingen  D, Kuijper  S, Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology. J Clin Microbiol. 1997;35:907–14.PubMedGoogle Scholar
  30. Warren  RM, Victor  TC, Streicher  EM, Richardson  M, van der Spuy  GD, Johnson  R, Clonal expansion of a globally disseminated lineage of Mycobacterium tuberculosis with low IS6110 copy numbers. J Clin Microbiol. 2004;42:5774–82. DOIPubMedGoogle Scholar
  31. Filliol  I, Driscoll  JR, van Soolingen  D, Kreiswirth  BN, Kremer  K, Valetudie  G, Snapshot of moving and expanding clones of Mycobacterium tuberculosis and their global distribution assessed by spoligotyping in an international study. J Clin Microbiol. 2003;41:1963–70. DOIPubMedGoogle Scholar
  32. van Soolingen  D, Qian  L, de Haas  PE, Douglas  JT, Traore  H, Portaels  F, Predominance of a single genotype of Mycobacterium tuberculosis in countries of east Asia. J Clin Microbiol. 1995;33:3234–8.PubMedGoogle Scholar
  33. Filliol  I, Driscoll  JR, Van Soolingen  D, Kreiswirth  BN, Kremer  K, Valetudie  G, Global distribution of Mycobacterium tuberculosis spoligotypes. Emerg Infect Dis. 2002;8:1347–9.PubMedGoogle Scholar
  34. Sun  YJ, Bellamy  R, Lee  AS, Ng  ST, Ravindran  S, Wong  SY, Use of mycobacterial interspersed repetitive unit-variable-number tandem repeat typing to examine genetic diversity of Mycobacterium tuberculosis in Singapore. J Clin Microbiol. 2004;42:1986–93. DOIPubMedGoogle Scholar
  35. Banu  S, Gordon  SV, Palmer  S, Islam  R, Ahmed  S, Alam  KM, Genotypic analysis of Mycobacterium tuberculosis in Bangladesh and prevalence of the Beijing strain. J Clin Microbiol. 2004;42:674–82. DOIPubMedGoogle Scholar
  36. Shamputa  IC, Rigouts  L, Eyongeta  LA, El Aila  NA, van Deun  A, Salim  AH, Genotypic and phenotypic heterogeneity among Mycobacterium tuberculosis isolates from pulmonary tuberculosis patients. J Clin Microbiol. 2004;42:5528–36. DOIPubMedGoogle Scholar
  37. Dale  JW, Al-Ghusein  H, Al-Hashmi  S, Butcher  P, Dickens  AL, Drobniewski  F, Evolutionary relationships among strains of Mycobacterium tuberculosis with few copies of IS6110. J Bacteriol. 2003;185:2555–62. DOIPubMedGoogle Scholar
  38. Narayanan  S, Das  S, Garg  R, Hari  L, Rao  VB, Frieden  TR, Molecular epidemiology of tuberculosis in a rural area of high prevalence in South India: implications for disease control and prevention. J Clin Microbiol. 2002;40:4785–8. DOIPubMedGoogle Scholar
  39. Sun  YJ, Lee  AS, Ng  ST, Ravindran  S, Kremer  K, Bellamy  R, Characterization of ancestral Mycobacterium tuberculosis by multiple genetic markers and proposal of genotyping strategy. J Clin Microbiol. 2004;42:5058–64. DOIPubMedGoogle Scholar
  40. Gutierrez  MC, Brisse  S, Brosch  R, Omais  B, Marmiesse  M, Supply  P, Ancient origin and gene mosaicism of tubercle bacilli. PLoS Pathog. 2005;1:e5. DOIPubMedGoogle Scholar

Main Article

1These authors contributed equally to this article.

Page created: November 17, 2011
Page updated: November 17, 2011
Page reviewed: November 17, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external