Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link

Volume 13, Number 1—January 2007

Research

Tickborne Relapsing Fever Diagnosis Obscured by Malaria, Togo

Annika Nordstrand*, Ignas Bunikis*, Christer Larsson*, Kodjo Tsogbe†, Tom G. Schwan‡, Mikael Nilsson§, and Sven Bergström*Comments to Author 
Author affiliations: *Umeå University, Umeå, Sweden; †Association Protestante des Oeuvres Médico-Sociales et Humanitaires du Togo, Lomé, Togo; ‡National Institutes of Health, Hamilton, Montana, USA; §The Swedish Institute for Infectious Disease Control, Solna, Sweden;

Main Article

Table 1

Primers used for cloning, PCR, and DNA sequencing

PrimerSequence (5′→3′)*Reference
Br_GlpQ_3_BamHIGGCGGATCCGCTTGACCAGTTGCTCCTCCGC (16)
Br_GlpQ_5_XhoIGCCGCTCGAGGAAAAGAAAATGCAAAAATAAATAAA (16)
GlpQ ForGGTATGCTTATTGGTCTTCPresent study
GlpQ RevTTGTATCCTCTTGTAATTGPresent study
GlpQ1CAAATCACTAAGCCTTAGCGAAAGATPresent study
GlpQ2ATCTGTTGGTGCTTCTTCCCAGTPresent study
GlpQ3CAGGGAAAATTGATAATGCTTGTTGGPresent study
GlpQ4CTGCTAATGTGAAATCGACGGAATAPresent study
Nested_1_FAGAGTTTGATCCTGGCTTAG (15)
Nested_1_RCTTGCATATCCGCCTACTCA (15)
Nested_2_FGGCTTAGAACTAACGCTGGCA (15)
Nested_2_RCTGCTGGCACGTAATTAGCC (15)

*Sequences in boldface indicate restriction sites for BamH1 and XhoI.

Main Article

References
  1. Helmy N. Seasonal abundance of Ornithodoros (O.) savignyi and prevalence of infection with Borrelia spirochetes in Egypt.J Egypt Soc Parasitol. 2000;30:607–19.PubMedGoogle Scholar
  2. Trape JF, Godeluck B, Diatta G, Rogier C, Legros F, Albergel J, The spread of tick-borne borreliosis in West Africa and its relationship to sub-Saharan drought.Am J Trop Med Hyg. 1996;54:289–93.PubMedGoogle Scholar
  3. Anda P, Sanchez-Yebra W, del Mar Vitutia M, Perez Pastrana E, Rodriguez I, Miller NS, A new Borrelia species isolated from patients with relapsing fever in Spain.Lancet. 1996;348:162–5. DOIPubMedGoogle Scholar
  4. Goubau PF, Munyangeyo C. Congenital relapsing fever caused by Borrelia duttoni. Apropos of a case in Rwanda.Ann Soc Belg Med Trop. 1983;63:367–9.PubMedGoogle Scholar
  5. Cadavid D, Barbour AG. Neuroborreliosis during relapsing fever: review of the clinical manifestations, pathology, and treatment of infections in humans and experimental animals.Clin Infect Dis. 1998;26:151–64. DOIPubMedGoogle Scholar
  6. World Health Organization. Vector control: methods for use by individuals and communities. Geneva: The Organization; 1997.
  7. Barbour AG. Antigenic variation of a relapsing fever Borrelia species.Annu Rev Microbiol. 1990;44:155–71. DOIPubMedGoogle Scholar
  8. Barbour AG. Borrelia species and antigenic variation.Trends Microbiol. 1993;1:236–9. DOIPubMedGoogle Scholar
  9. Meier JT, Simon MI, Barbour AG. Antigenic variation is associated with DNA rearrangements in a relapsing fever Borrelia.Cell. 1985;41:403–9. DOIPubMedGoogle Scholar
  10. Shamaei-Tousi A, Martin P, Bergh A, Burman N, Brännström T, Bergström S. Borrelia crocidurae induces formation of microemboli.J Infect Dis. 1999;180:1929–38. DOIPubMedGoogle Scholar
  11. Trape JF, Duplantier JM, Bouganali H, Godeluck B, Legros F, Cornet JP, Tick-borne borreliosis in west Africa.Lancet. 1991;337:473–5. DOIPubMedGoogle Scholar
  12. Lecompte Y, Trape JF. West African tick-borne relapsing fever.Ann Biol Clin (Paris). 2003;61:541–8.PubMedGoogle Scholar
  13. Vial L, Diatta G, Tall A, Ba el H, Bouganali H, Durand P, et al. Incidence of tick-borne relapsing fever in west Africa: longitudinal study.Lancet. 2006;368:37–43. DOIPubMedGoogle Scholar
  14. van Dam AP, van Gool T, Wetsteyn JC, Dankert J. Tick-borne relapsing fever imported from West Africa: diagnosis by quantitative buffy coat analysis and in vitro culture of Borrelia crocidurae.J Clin Microbiol. 1999;37:2027–30.PubMedGoogle Scholar
  15. Brahim H, Perrier-Gros-Claude JD, Postic D, Baranton G, Jambou R. Identifying relapsing fever Borrelia, Senegal.Emerg Infect Dis. 2005;11:474–5.PubMedGoogle Scholar
  16. Porcella SF, Raffel SJ, Schrumpf ME, Schriefer ME, Dennis DT, Schwan TG. Serodiagnosis of louse-borne relapsing fever with glycerophosphodiester phosphodiesterase (GlpQ) from Borrelia recurrentis.J Clin Microbiol. 2000;38:3561–71.PubMedGoogle Scholar
  17. Kisinza WN, McCall PJ, Mitani H, Talbert A, Fukunaga M. A newly identified tick-borne Borrelia species and relapsing fever in Tanzania.Lancet. 2003;362:1283–4. DOIPubMedGoogle Scholar
  18. Melkert PW, Stel HV. Neonatal Borrelia infections (relapsing fever): report of 5 cases and review of the literature.East Afr Med J. 1991;68:999–1005.PubMedGoogle Scholar
  19. Climate information for Togo. 2005. [cited 2006 Oct 17]. Available from www.climate-zone.com/climate/togo
  20. Colebunders R, De Serrano P, van Gompel A, Wynants H, Blot K, van den Enden E, Imported relapsing fever in European tourists.Scand J Infect Dis. 1993;25:533–6. DOIPubMedGoogle Scholar
  21. Nordstrand A, Barbour AG, Bergstrom S. Borrelia pathogenesis research in the post-genomic and post-vaccine era.Curr Opin Microbiol. 2000;3:86–92. DOIPubMedGoogle Scholar
  22. Nordstrand A, Shamaei-Tousi A, Ny A, Bergstrom S. Delayed invasion of the kidney and brain by Borrelia crocidurae in plasminogen-deficient mice.Infect Immun. 2001;69:5832–9. DOIPubMedGoogle Scholar

Main Article

Page created: June 28, 2010
Page updated: June 28, 2010
Page reviewed: June 28, 2010
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external